SGN Marker CT133

SGN-M483

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TGCTCATTTCGGACCCGAATAGTGCGAAGTCAATCGGATTATTGTGCTTCCGTCAAGAGGACGCCGAGGCATTTCTTGCTCAGGTACGGT
TGCGGAAGAAGGAAGTGAGAGGTGGAGCTAAGGTAGTTCCGTTGACACTTGATCAGGTTTACATGTTGAAGGTTGAAGGAATCGCATTTC
GTTTTTTGCCAGATCCCGTTCAAATTAAGAATGCAATGGAGTTAAAAGCTTCTGATGTAAAGACTGGATTTGATGGAGTCCCTGTTTTCC
AGTCAGATCTCCTAGTTGTGAAAAAGAGAAACAGACGATACTGTCCAATATACTTTCGAAAGGAGGATATAGAAAAGGAGTTATCATCAA
GGGCATTGAGAGGATCTAGTGTCTCTCAGCACATCATGGTAGGGACTTTGGAAGATGTCCTGAAAAAAATGGAGATAAGTCAGAGAAATT
CTGGCTGGGAGGACCTTATCTTTATTCCCCC
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTTTTAAGGGACAACATGGTAGTTGTTCCCCCCCTTAAA
TATTCCAGCAAAAACTTGGTCATTTTTGGTTCTTCTTAAAGCCAATCCCGCCGGATGGGGCTTAACTATTTGGATTATTCGGGGCCACCC
AGGGGAAAAGAAAAAGGGAACCCGCCCCTATATTGATTTGTTTCAAACAGGGGCTGGTTGCAAAAAATTTTTGCTTTAAAAACATCTTGA
ATGGGGTGGGAAAGACTTTTACCCGGGGGAAAAAAAAAAAGGGCCCCCCCGCCAAAATTTCTCTGAATTATCCCCCTTTTTTTCAGGGAA
TCTTCCAAAGGCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U147852481 (100.0% of RFLP seq)+
SGN-U1478526.6e-0653 (14.2% of RFLP seq)-
SGN-U1478522e-21143 (38.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9267)
Chromosome
4
Position
102.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT133 was used as an overgo probe on plate 9 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCATTTCTTGCTCAGGTACGGTTG
B sequence
TCACTTCCTTCTTCCGCAACCGTA
AB sequence
GCATTTCTTGCTCAGGTACGGTTGCGGAAG
Marker sequence
TGCTCATTTCGGACCCGAATAGTGCGAAGTCAATCGGATTATTGTGCTTC
CGTCAAGAGGACGCCGAGGCATTTCTTGCTCAGGTACGGTTGCGGAAGAA
GGAAGTGAGAGGTGGAGCTAAGGTAGTTCCGTTGACACTTGATCAGGTTT
ACATGTTGAAGGTTGAAGGAATCGCATTTCGTTTTTTGCCAGATCCCGTT
CAAATTAAGAATGCAATGGAGTTAAAAGCTTCTGATGTAAAGACTGGATT
TGATGGAGTCCCTGTTTTCCAGTCAGATCTCCTAGTTGTGAAAAAGAGAA
ACAGACGATACTGTCCAATATACTTTCGAAAGGAGGATATAGAAAAGGAG
TTATCATCAAGGGCATTGAGAGGATCTAGTGTCTCTCAGCACATCATGGT
AGGGACTTTGGAAGATGTCCTGAAAAAAATGGAGATAAGTCAGAGAAATT
CTGGCTGGGAGGACCTTATCTTTATTCCCCC
Genomic location of CT133  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D483 marker 483
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)