SGN Marker CT77

SGN-M484

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT77 image not available
Forward sequence
CTTTTTTTTTTTTTTTCTCAACAAAAACCCCATTCACAAAAGCTTCATTCTTCAATTTTCACATAATTTTTTTTTCTTCATTTGATGGAA
TCTTCGTTGCCGGTGGAGGAGCTTACTTCCGGCGCAAGAGGTCGGATAATTCCTCTTTTCAAAAATCTTCACCGGTCAGTTTTCTCATAC
CAAACTTACCGGAGACTAATTATATTTATACAGTCTATTTTCCTATGGGTAATTCTTCTGTCTCGACAGAGGTTCTCCACGTCACCTTCG
TCTCCTCCGCCTTCGCCATCTGCAGCTACTACGGGGGTGTTGGGGAATAGGAGGAAATTTGCTTTGCGGAGGGATGAAGAGGATACTCAG
AGAAGGAGGGCTCTTGCTGAGGCGTTAGATATGACGGATGAGAATGACGGTGTGAGCTGCCGTTGGAATACATCTTTGTTCTTTGGGGCT
CATCGGAATGCTTTGTTTTGCCGATCGAGGTTTCCGGATACAGATGAATTGAGG
Reverse sequence
TTTTTTTTTTTTTTACCCAACATAAAGAAGATTGTGTTGTGTTCATAGAATACATAGTCTAAAGATCAGCAACACTAATTTTACTACTAC
ACACACTATACAAGCTTGGATAGTGGGAATCATCTTTGTAATTCCATTGGAGAAGAGAAGCAAAGTAGGATAACTGATGAAATAAATAAA
TAGAACAGCATCCCCTTTGATCAATCAAAACACTAATGATTTAGAAAACTAGCACTGACTATACACATTTGCAAGATTGCCAGAATCTAA
CTTCTTGTGCATCCAATCAATGATATCCTGGGCAATTTCTTCACGCTCAGGCTCAAATAGAAGATCGTGCAAGAATCCATCATAAAGTTT
AATGTCTTTGAATTCAGAAGCAGCCTCATTGTACAAATCTTGAGAAGCCAATGGATCAGTCACTCTATCAGCAGATCCATGGAGGACTAA
GAATGGGACAGTGACTGACTTGAAGTTCCGCATCAAGTAAGACGAGATACGCAGAATCTCATGCCCTGTCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U149725483 (95.8% of RFLP seq)+
SGN-U149725327 (62.6% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49348)
Chromosome
8
Position
52.28 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47284)
Chromosome
8
Position
35.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42358)
Chromosome
8
Position
41.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41577)
Chromosome
1
Position
173.20 cM
Confidence
I
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39069)
Chromosome
8
Position
30.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9273)
Chromosome
8
Position
60.37 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 9272)
Chromosome
8
Position
137.23 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 9269)
Chromosome
8
Position
26.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9268)
Chromosome
8
Position
20.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT77 was used as an overgo probe on plate 13 [well A3]

Plausible BAC Matches:   P190P06,   P051M12,   P294K15,   P120A01,   P327I13,   P097D09,   P140G03,   P017I23,   P024J01

 Overgo Sequences

A sequence
TGCTGAGGCGTTAGATATGACGGA
B sequence
CACACCGTCATTCTCATCCGTCAT
AB sequence
TGCTGAGGCGTTAGATATGACGGATGAGAA
Marker sequence
CTTTTTTTTTTTTTTTCTCAACAAAAACCCCATTCACAAAAGCTTCATTC
TTCAATTTTCACATAATTTTTTTTTCTTCATTTGATGGAATCTTCGTTGC
CGGTGGAGGAGCTTACTTCCGGCGCAAGAGGTCGGATAATTCCTCTTTTC
AAAAATCTTCACCGGTCAGTTTTCTCATACCAAACTTACCGGAGACTAAT
TATATTTATACAGTCTATTTTCCTATGGGTAATTCTTCTGTCTCGACAGA
GGTTCTCCACGTCACCTTCGTCTCCTCCGCCTTCGCCATCTGCAGCTACT
ACGGGGGTGTTGGGGAATAGGAGGAAATTTGCTTTGCGGAGGGATGAAGA
GGATACTCAGAGAAGGAGGGCTCTTGCTGAGGCGTTAGATATGACGGATG
AGAATGACGGTGTGAGCTGCCGTTGGAATACATCTTTGTTCTTTGGGGCT
CATCGGAATGCTTTGTTTTGCCGATCGAGGTTTCCGGATACAGATGAATT
GAGG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT77  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D484 marker 484
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)