SGN Marker CT135

SGN-M486

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTATGTAACAACAATTGAAGTTTCCATTTGATATCCAAAATTTTGCATCATTTCTATGTATTGTATTTGACTATTAT
TCTATAACGTGACACCATATGGCGATAGAAATAAAATTACTCGCTTGCCCCTTATACATAAAATTGGAACATTTAGAACTATTTGTTAAA
GGAAATTAGTGCCTGCATGATTTTGATGCAAGAGTTGGTGAGCAATCTGATCCCTAGCTTGTACAGCATTCATTGACCTCACAATATTTT
CTGGAACCATTTCATCATCGAAAAGATCAAATCTCAGCCCTGGATTCAGTTGTTCACCTCTCATCTCGCAAATATTATGCAATACACAGC
AAGCCCCCAATACCACAGGCAAATCTTGAAGCTTCACTTCTGTTCTCTTGCGTAAGCAGCTCCACCTAGCTTTCATTCGCATAAACGCCT
CTTTAGCAACCTTTTGGACTTCCCCTACTTTTT
Reverse sequence
TTTTTTTTTTTTTTTAATGGAAATTTCTTCTTTCCTATTTCCCAATCAGGAAGATTATCCTTCTCCTAATTTCTTCAGTTTTTTTCAAGA
TTTTGACTTCCCTACTACTGATACTCTTGCTCCGATAGTTGCTGAACCGCTTCCTAAAAAGCAAAGAGTTGATGATTTTGATTTTGATTT
GGAACAAGTTGTTGAACAGCAGGGCTCTTTGAAGAGTGTTGAGGATATATTAAACAAATTTTTGGGATTTGATAAGGAAGAAGACAAAAC
GAACCTTAAGCAATTCACAAATCAAAATCAATCTGTTTTTGACTTTTCGAATCAACAACCTACCGGGTTAATAATGATAAATGAGAAAGT
GAAGCCAATGGCGAGTACGAATAACAAAAGGTCTCGTCAGGGTTCTGCTGAATTCATTTCAACTTCGGAGGAGGAATCTCAGCCTCAACA
GCAAAGGAGGTTATGGGTGAAAGACAGGTCTAAAGCATGGTGGGAACAGTGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1464141.4e-1077 (15.9% of RFLP seq)+
SGN-U1452563.7e-1186 (17.8% of RFLP seq)+
SGN-U144771454 (94.0% of RFLP seq)+
SGN-U1452563.5e-0548 (9.5% of RFLP seq)-
SGN-U144771488 (97.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53445)
Chromosome
7
Position
39.04 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49317)
Chromosome
7
Position
48.55 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47255)
Chromosome
7
Position
26.66 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41574)
Chromosome
7
Position
37.10 cM
Confidence
I
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38972)
Chromosome
7
Position
23.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9280)
Chromosome
7
Position
53.10 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 9279)
Chromosome
7
Position
56.02 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9275)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9276)
Chromosome
12
Position
30.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT135 was used as an overgo probe on plate 6 [well B7]

Plausible BAC Matches:   P015O12,   P191O01,   P272N22,   P143I13,   P126C11,   P304P17,   P034N16,   P156P04,   P226C12,   P244L05,   P302K09,   P273I22,   P145I04,   P092A12,   P285M08,   P188B22,   P173F19,   P167J19

 Non-Plausible BAC matches

P302K10,   P124P24,   P201O12,   P245M14,   P287L01,   P303O08,   P267O16

 Overgo Sequences

A sequence
CAAGAGTTGGTGAGCAATCTGATC
B sequence
TGCTGTACAAGCTAGGGATCAGAT
AB sequence
CAAGAGTTGGTGAGCAATCTGATCCCTAGC
Marker sequence
CTTTTTTTTTTTTTTATGTAACAACAATTGAAGTTTCCATTTGATATCCA
AAATTTTGCATCATTTCTATGTATTGTATTTGACTATTATTCTATAACGT
GACACCATATGGCGATAGAAATAAAATTACTCGCTTGCCCCTTATACATA
AAATTGGAACATTTAGAACTATTTGTTAAAGGAAATTAGTGCCTGCATGA
TTTTGATGCAAGAGTTGGTGAGCAATCTGATCCCTAGCTTGTACAGCATT
CATTGACCTCACAATATTTTCTGGAACCATTTCATCATCGAAAAGATCAA
ATCTCAGCCCTGGATTCAGTTGTTCACCTCTCATCTCGCAAATATTATGC
AATACACAGCAAGCCCCCAATACCACAGGCAAATCTTGAAGCTTCACTTC
TGTTCTCTTGCGTAAGCAGCTCCACCTAGCTTTCATTCGCATAAACGCCT
CTTTAGCAACCTTTTGGACTTCCCCTACTTTTT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT135  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D486 marker 486
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)