SGN Marker TG234

SGN-M489

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1690
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG234 image not available
Forward sequence
CAGCCAATAAAATATCAGAAGCTTCTCGATATACTCTACAATAGAACCTCAAGAAGCAATGCAGTCTCTGGATTATGCTAGATCACTCAA
TTGCAGTTTGCAATCTTGGATGCAGTAAATTATACATAAGAGTCAAGAAGTAAATCATATCAAGATAACACCAACTATATGTGCTTCCAT
ATATCCAGATATTAGAGCAGTTTTTGGTTCCTTTTTCTCCGAATATAGAAAAATTAGCAAGTGTGGCAAGAGAAATCATCTCTATATTCA
CTGTCTAACTTGACATGAAATAATATCTAGTAAACGATAATCAGCCATTAAGGAAAAACAGTTGATTCCAGGATAGCAAATGATGAAAAC
AAAGAAGTACCAAGTATATTTGATATCCTTCCTATATTTTGCCCATACACGCTCTTGAATTTCACTCTTTGGAATAATTTCAACAGCAGT
TAGTATATCTCCTTCAACAGCTTTCCCAGTAAGAGCCACCGTCTCAATTC
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53228)
Chromosome
2
Position
69.78 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Potato-TXB 1992   
Map version
27 (location: 9288)
Chromosome
2
Position
11.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9289)
Chromosome
2
Position
11.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Genomic location of TG234  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D489 marker 489
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)