SGN Marker CT181

SGN-M49

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT181 image not available
Forward sequence
ATAAAATGAGAACAACTTCCTCCCTTTTATATATATTCCTTCTCCAAATTCTCAACCATGAAGTTCCCCAAAAACTTCTTCAAGTCCAAA
AAATCCAGATCCCTTTCCCGATCCGATGATCCATCTTACTCATCTTCCTCCTCCTCCTCCAACAAAGGCGGTAGCGTGGGAGGAATTTCT
ACTCCTACGAGCGTGTTACCTACTTTATCCAACGAGATCTCAGCTGATGAGTGGTACGACATCTCTACCGCCGGAGTTTACTACGATCTC
G
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1455231.9e-0829 (10.7% of RFLP seq)+
SGN-U1455235e-126238 (87.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38998)
Chromosome
4
Position
58.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7868)
Chromosome
4
Position
44.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT181 was used as an overgo probe on plate 9 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGCGTGGGAGGAATTTCTACTCC
B sequence
AGGTAACACGCTCGTAGGAGTAGA
AB sequence
TAGCGTGGGAGGAATTTCTACTCCTACGAG
Marker sequence
ATAAAATGAGAACAACTTCCTCCCTTTTATATATATTCCTTCTCCAAATT
CTCAACCATGAAGTTCCCCAAAAACTTCTTCAAGTCCAAAAAATCCAGAT
CCCTTTCCCGATCCGATGATCCATCTTACTCATCTTCCTCCTCCTCCTCC
AACAAAGGCGGTAGCGTGGGAGGAATTTCTACTCCTACGAGCGTGTTACC
TACTTTATCCAACGAGATCTCAGCTGATGAGTGGTACGACATCTCTACCG
CCGGAGTTTACTACGATCTCG
Genomic location of CT181  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D49 marker 49
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)