Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG162

SGN-M490

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CCCTGCATTAATTAATGGTGTTCAAGGACGAGAAGGAGTGAGACTAAGAGAAACATTTCTCTTCTAGTAGAACTTATATGTACACCGACA
AGACCAACACTACCACAGATAACAACTGTCACTAAACTAACAGGAAATAAGAATCCCACACCTGGACATCCAGTAATTCCTACAATATCA
CCACGCTTCACACCAGAATGAAATTTAATGAAGTCTTCTTCATTCGACACAGAATCTCTGCGAATATATAAGGACATAATAATTCTCAAT
GAAAAGAAAATTCTATTTCTCACAAACAACAAAATGATAAGAGTAATAGAACCACCTTGCACTTGTCATGACTTGAACTTTGGCACCTTC
ACCATGTAAATCATAGAAAAGCAGCTTTGCAGAAGAGGCACGTTTGTTCATTATCCTTCCTATCGAAAAAAACAATCATTGATGCAAATT
TATTTTTTTTAACAAAAAAC
Reverse sequence
GTACACCAATCCAATAAAATACATAAACATTGTGTTTTCAGTTCCTTTCCCCTGCATTAATTAATGGTGTTCAAGTACGTGATGGAGTGA
GACTAAGAGTAACATTTCTCTTCTAATAGAACTTATTTGTACACCGCCAAGACCAACACTACCACAGATAACAACTGTCACTAAACTAAC
AGGAAATAAGAATCCCACACCTGGACATCCAGTAATTCCTACAATATCACCACGCTTCACACCAGAATGAAATTTAATGAAGTCTTCTTC
ATTCAACACAGAATCTCTGCAAATATATAAGGACATAATAATTCTCAATGAAAAGAAAATTCTATTTCTCACAAACAACAAAATGATAAG
AGTAATAGAACCACCTTGCACTTGTCATGACTTGAACTTTGGCACCTTCACCATGTAAATCATAGAAAAGCAGCTTTGCAGAAGAGGCAC
GTTTGTTCATTATCCTTCCTATCGAAAAAAACAATCATTGATGCAAATTTATTTTTTTTAACA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1463683.3e-4290 (19.1% of RFLP seq)+
SGN-U1463681.4e-4795 (20.2% of RFLP seq)+
SGN-U1463681.5e-4490 (17.5% of RFLP seq)-
SGN-U1463681.5e-4795 (18.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53188)
Chromosome
6
Position
60.27 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42411)
Chromosome
6
Position
100.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9291)
Chromosome
6
Position
108.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9290)
Chromosome
6
Position
63.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9292)
Chromosome
6
Position
40.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG162 was used as an overgo probe on plate 4 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P101K08,   P335B20,   P282I23,   P059D21

 Overgo Sequences

A sequence
GAACCACCTTGCACTTGTCATGAC
B sequence
AGGTGCCAAAGTTCAAGTCATGAC
AB sequence
GAACCACCTTGCACTTGTCATGACTTGAAC
Marker sequence
CCCTGCATTAATTAATGGTGTTCAAGGACGAGAAGGAGTGAGACTAAGAG
AAACATTTCTCTTCTAGTAGAACTTATATGTACACCGACAAGACCAACAC
TACCACAGATAACAACTGTCACTAAACTAACAGGAAATAAGAATCCCACA
CCTGGACATCCAGTAATTCCTACAATATCACCACGCTTCACACCAGAATG
AAATTTAATGAAGTCTTCTTCATTCGACACAGAATCTCTGCGAATATATA
AGGACATAATAATTCTCAATGAAAAGAAAATTCTATTTCTCACAAACAAC
AAAATGATAAGAGTAATAGAACCACCTTGCACTTGTCATGACTTGAACTT
TGGCACCTTCACCATGTAAATCATAGAAAAGCAGCTTTGCAGAAGAGGCA
CGTTTGTTCATTATCCTTCCTATCGAAAAAAACAATCATTGATGCAAATT
TATTTTTTTTAACAAAAAAC
Genomic location of TG162  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D490 marker 490
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)