SGN Marker TG236

SGN-M491

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1010
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG236 image not available
Forward sequence
AGAAATATACTTCAATTATAAATAGCCCAAGAAAACCACCCAAAGTGACTGGATGTTTAAAGGAACGCCTTGCAGTTATTTAAGGGATGA
AGGAAGGAAAAGAGCAGTTCTAGTTGAGGAAAACATTGTTTCAAAGTCTAAAATAAACCTAAAATGCACAAAGAAAACTTTGTATATTGA
AGTTCTGCTGCACTCTGTTCTTTCCATATCCTAATTCCTTCACTAATTGCTGTACAAAAAGGTTAGCTAACAAGTAAAATGCCTTCATGA
AGTAATCTTTACTCTTTTGTCAATCAAAAGAATAAGGTGTTCATTAATAGAAGATGTCCTAACAGCAAGATACAAACTTTTGCAGCATCG
CGGATAATTCTTTTTCTCCTTTAATGAAGAAGTGGCAGGTCCTTATAATGAATGAAAAAGGAGGAAGTCGAAAAGAAAAAAAGGTGAAAC
CTCTTAATTTGATAAGCAGAAAAGCGAAACACATGCACATAG
Reverse sequence
GGGAGACAGCTTGCATGCCTGCAGGTTTAGTCTTTTTGAAAGGGTCGAGAGATTACATAACGTTGAGTCTTCACCTCTCCCTTGCCTCGC
AAGAACGTTATTAAACTAGAAGAAAACAAATTCTAGGCATGTCTTTCTAAATGAAAGATGTTAGATCACTTAGATAACTAATTAGACATA
ATCCAATCAACTATTGGTGTTTTAGATAAATATTAAAATCTTCATGTGTGTCTGTACTTTTATATGATAAAAATAGATAAACTACTTTAG
AAGACCAAGTTAAATAAACACACTCCTATTTCCTATTGTAGAGTGTTGAAATCCCATTTACCCAACAATTTGTTTTTTGCTTTACTTTGT
ATAAAGGTGTATTTCCTTGTTTCTGGATAGTGATTCATCTCTTTAATGTCATTTCTTGTTACTTCTCCCAACAGAGTGAAGTCCCTCTTG
TTGGAAATAAAGCACCAGATTTTGAGGCTGAGGCTGTTTTTGATCAAGAGTTCATCAAGGTAATATATTGGTGTTAAATGAATAAACAGT
G
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1432621.9e-2277 (14.2% of RFLP seq)-
SGN-U1432641.9e-2277 (14.2% of RFLP seq)-
SGN-U1432639e-3777 (14.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40846)
Chromosome
1
Position
19.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36575
Forward primer (5'-3')
CTCAAGCTCCAGCTGTTTCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
GCTCCTTCTGCAATGGGTAA
Digested band sizes (using NlaIII)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39953)
Chromosome
1
Position
23.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9293)
Chromosome
1
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35623
Forward primer (5'-3')
AGCCCAAGAAAACCACCCAAAGTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 350+650
Solanum lycopersicum LA925: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGTCGAGAGATTACATAACGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG236 was used as an overgo probe on plate 3 [well F10]

Plausible BAC Matches:   P240P19

 Overgo Sequences

A sequence
AACCACCCAAAGTGACTGGATGTT
B sequence
GCAAGGCGTTCCTTTAAACATCCA
AB sequence
AACCACCCAAAGTGACTGGATGTTTAAAGG
Marker sequence
AGAAATATACTTCAATTATAAATAGCCCAAGAAAACCACCCAAAGTGACT
GGATGTTTAAAGGAACGCCTTGCAGTTATTTAAGGGATGAAGGAAGGAAA
AGAGCAGTTCTAGTTGAGGAAAACATTGTTTCAAAGTCTAAAATAAACCT
AAAATGCACAAAGAAAACTTTGTATATTGAAGTTCTGCTGCACTCTGTTC
TTTCCATATCCTAATTCCTTCACTAATTGCTGTACAAAAAGGTTAGCTAA
CAAGTAAAATGCCTTCATGAAGTAATCTTTACTCTTTTGTCAATCAAAAG
AATAAGGTGTTCATTAATAGAAGATGTCCTAACAGCAAGATACAAACTTT
TGCAGCATCGCGGATAATTCTTTTTCTCCTTTAATGAAGAAGTGGCAGGT
CCTTATAATGAATGAAAAAGGAGGAAGTCGAAAAGAAAAAAAGGTGAAAC
CTCTTAATTTGATAAGCAGAAAAGCGAAACACATGCACATAG
Genomic location of TG236  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D491 marker 491
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)