SGN Marker TG164

SGN-M492

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG164 image not available
Forward sequence
CGAACAAAATAAGATATCTTACGAAACAAAGTCTAAAAGATGCTCAAGCATTCACGTTTGGTATAGTTTCATGCACATCTGAAGTCTGAA
CTTGAAAACTATCAATTACATCCAACAAACACAGTCGAGTGTCTATAGGCTCTAATACAGCTTTGGTTTATATGAAGCCAAAATTTTGAA
ACAAAGCTTCTTCACCACTAAAACAAAATGAAGAGTTATAGCTTTCAAGTTCACTGCACTAAGCTATAATTCGAGGAAGATATTGCAGGA
AATGTCGTAACTGAATCAAAGAAACCTACAGGTAACATGTATGTTAGTGAACAGTGGATGCAGATCCTAATATTTGTCTTGCCGATTCCA
AGATATGATACAACTCACAAGGGAACAAATGTAATGAACCAGGGCAGCTTCCCAGCATCTATAGAAAATACAGAAGAAAAACATTTTGTT
GAGTACTCCTGAAGTAGTTGTGAAGATTAATATGAATCTCTTGGTTCCCCATAGTCTT
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGAAAAGAGCTTCCTAGTGTCACTGGGGCATGAATATCATAAATGACTATCTGTTTTCT
TAATGACTATATCATTGACTTGAATCTAATTGAAGTTATGCCAAGGGACGATCGAACAAATCCTTTTAACATTGACCAAAGTCACCCAGT
CAACTTTTCTCCTTTTGAACCCTGAACGAGTACTTTGCTATTTTAAGGATGATTGTTTCCTATGTTGCTTGGTGTTTTAATAATATAACA
TAATTCAAAAGCTCTTACCTCCTGTACATTTCATATTAATGTATGATTTTATTACCAGGGGGGCTATCATCCACAAGAAGTACTTGTATG
GCTCAGCTGCTTTGCTTCCACTGTCATCATTTTTCATGGTATTGATACACTATTTATGAAATGTCAAGTCTTATATTTAGTTTTCTCTTT
CTGATCATATTGAGATGTACCATGTTCTTACTTTCGCCTCTTTTTATGTGATCCTCTTGATTTTTAGTGTTGTGATTCTCTTGCTTTTCT
CAATTTATTTTCATATCATGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1495303e-107195 (38.4% of RFLP seq)+
SGN-U1495305.8e-3574 (13.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9296)
Chromosome
6
Position
37.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9297)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG164 was used as an overgo probe on plate 4 [well D11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCAACAAACACAGTCGAGTGTCTA
B sequence
GCTGTATTAGAGCCTATAGACACT
AB sequence
CCAACAAACACAGTCGAGTGTCTATAGGCT
Marker sequence
CGAACAAAATAAGATATCTTACGAAACAAAGTCTAAAAGATGCTCAAGCA
TTCACGTTTGGTATAGTTTCATGCACATCTGAAGTCTGAACTTGAAAACT
ATCAATTACATCCAACAAACACAGTCGAGTGTCTATAGGCTCTAATACAG
CTTTGGTTTATATGAAGCCAAAATTTTGAAACAAAGCTTCTTCACCACTA
AAACAAAATGAAGAGTTATAGCTTTCAAGTTCACTGCACTAAGCTATAAT
TCGAGGAAGATATTGCAGGAAATGTCGTAACTGAATCAAAGAAACCTACA
GGTAACATGTATGTTAGTGAACAGTGGATGCAGATCCTAATATTTGTCTT
GCCGATTCCAAGATATGATACAACTCACAAGGGAACAAATGTAATGAACC
AGGGCAGCTTCCCAGCATCTATAGAAAATACAGAAGAAAAACATTTTGTT
GAGTACTCCTGAAGTAGTTGTGAAGATTAATATGAATCTCTTGGTTCCCC
ATAGTCTT
Genomic location of TG164  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D492 marker 492
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)