SGN Marker TG166

SGN-M494

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3030
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGCATTTTTACCTTGACTAATTGATTTGGCCTGAAAGCTTCCAAACTTAGTTGTACTATTCCTGTTTCGAAGGTTTTCTTTCACCACCT
GAAACAAAGATTGAATATGTCCTTACAAACCAATATCAATTTTATAGTATTAAATGGATAACAACCACACAAAAGCAATCCATGATATGA
TTTCTTACAGTATTTTAAGTTATTGAATATGCATTTTCAATTAATGCTCATATCTTGTTTATTAACTTCTGGGGACGTTCTATTTCTTAC
TAGGAGAAAAGTCAAATATCCTCCAGATAGGCATCTTCTTACTAGGAGAAAAGTCAAATATCCTCCAGATAGGCATACTTATACCACAGG
AAATTCTCATCTACCTAGATTCTCACTGTATATAGACATGGAATAATATAGCATATGCTAGAGTTGGACTATATGACGATAGTAGTTGAG
GAGCAGAGACATGGATAGAAGGGAGGGTCTTATCAAATGTGAATAATAATAA
Reverse sequence
CTCCTATAGGGAGACAGCCTGCATGCCTGAAGGCTTTGGATGAAAGGCCCAATGCTGTATTTAGAGCTCCTGTTGATGACACTCAGGTAG
TTTCTTATCTTTTCTATTAAAAAGGGAGCTATTGTTAGTAACACCAGGTTTGCAAATAGCCAAAGAAAATCTGAATGCTGGAGCTTTTTC
AATTTGTCAGGATCTATTTGATGATTCTGAACCAACTGGCAGTAAGGATGAGATACTTGATGACCTGGCCTCTAGTCCTTCAGAAGAAGT
AATGGCACCGTCTCTCCTTGCTTTGAACTTGAAGTTTGATTCTGTCCCTCCAGATGAAAGGTAATTGGTTCGGAAGTATCTATGCATGCA
AATCTAATAATGTTTTACTGCAACCTAGGCTGGAAAAGCTCCTATTTTCTCTTTTGCAAAGGATCATATATCCACAAACAAAAAAGTTTA
TTTGTTTGTTGTCATTATTTTATGCTAAAATATGTCAGCTTAGTTATTGCAATTAACTCCAGAAAATAAAAATATTTCCCTTTCAGAAGT
TCATCAGATGAGGAGGATAATGACA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1717175.8e-4489 (17.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53192)
Chromosome
7
Position
30.80 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53191)
Chromosome
6
Position
29.99 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9301)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9303)
Chromosome
7
Position
48.70 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9302)
Chromosome
6
Position
18.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG166 was used as an overgo probe on plate 9 [well A12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P010P15,   P134I13,   P175O05,   P206O08,   P094G09,   P335L09,   P261C13,   P205J05,   P271D23,   P303M24,   P049F01,   P324P13,   P079L23,   P056B16,   P010J13

 Overgo Sequences

A sequence
AGTAGTTGAGGAGCAGAGACATGG
B sequence
AGACCCTCCCTTCTATCCATGTCT
AB sequence
AGTAGTTGAGGAGCAGAGACATGGATAGAA
Marker sequence
CAGCATTTTTACCTTGACTAATTGATTTGGCCTGAAAGCTTCCAAACTTA
GTTGTACTATTCCTGTTTCGAAGGTTTTCTTTCACCACCTGAAACAAAGA
TTGAATATGTCCTTACAAACCAATATCAATTTTATAGTATTAAATGGATA
ACAACCACACAAAAGCAATCCATGATATGATTTCTTACAGTATTTTAAGT
TATTGAATATGCATTTTCAATTAATGCTCATATCTTGTTTATTAACTTCT
GGGGACGTTCTATTTCTTACTAGGAGAAAAGTCAAATATCCTCCAGATAG
GCATCTTCTTACTAGGAGAAAAGTCAAATATCCTCCAGATAGGCATACTT
ATACCACAGGAAATTCTCATCTACCTAGATTCTCACTGTATATAGACATG
GAATAATATAGCATATGCTAGAGTTGGACTATATGACGATAGTAGTTGAG
GAGCAGAGACATGGATAGAAGGGAGGGTCTTATCAAATGTGAATAATAAT
AA
Genomic location of TG166  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D494 marker 494
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)