SGN Marker TG80

SGN-M498

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG80 image not available
Forward sequence
AAAAATTTTCAAAAAAAAAAATTTTTTGGGCCGCCCCCGACCCCTTGGGGGGAAAATAAACAAGGGCCCCCCATTTTTCCCCCCCCTTTT
TTAACCCGCCCCTTGGGGGAAAAAATTCCCATTTCTTAAACCGGCCTTTTTTCCCAGGTTTCTTCCCACCTTTAAAAAACCTTGGGAAAA
AGTACCGGGGTAAGAAATTAACATTCTTTTAAGGAACCTCCCCCTAAAAAAATTGGGCCCCAAAATGGGAGGCCCCTTTTTGGGTCCCCC
CAACGGGGTTGGGGGGGCCCAAACCAATTTTTTTTGTTTAATTAAAAAAACCCCCCCCCCCCGCGGGGGGAGGGATCCCCGGGAATTCC
Reverse sequence
AAAAAAATTTCAAAAAAAAAAATTTTTTGGGCCGCCCCCATCCCCTTGGGGGGAAAAAAAACAAAAACCCCCCAATTTTCCCCCCCCTTT
CTAAACCCCCCCCTTGGGGGAAAAAACTCCCATTTCTTAAACCCACCTTTTTTCACCGGTTTTTTCCCACTTTTAAAAAACTTTGGGAAA
AAGAACCCGGGTAACCAATTAACATTCTTTTAAGGGACCTCCCCCAAAAAAGATTGGGCCCCAAAATGGGAGGCCCGTTTTTGGGAACGC
CCAACGGGGTCGGGTGGGCCCAAACCCAGATTTTTTGTTTAATTAAAAAACCCCCCCCCCCCTGCGGGGGAAGGGATCCCCGGGAATTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9306)
Chromosome
1
Position
22.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG80 was used as an overgo probe on plate 5 [well G5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAACCTCCCCCTAAAAAAATTGGG
B sequence
GCCTCCCATTTTGGGGCCCAATTT
AB sequence
GAACCTCCCCCTAAAAAAATTGGGCCCCAA
Marker sequence
AAAAATTTTCAAAAAAAAAAATTTTTTGGGCCGCCCCCGACCCCTTGGGG
GGAAAATAAACAAGGGCCCCCCATTTTTCCCCCCCCTTTTTTAACCCGCC
CCTTGGGGGAAAAAATTCCCATTTCTTAAACCGGCCTTTTTTCCCAGGTT
TCTTCCCACCTTTAAAAAACCTTGGGAAAAAGTACCGGGGTAAGAAATTA
ACATTCTTTTAAGGAACCTCCCCCTAAAAAAATTGGGCCCCAAAATGGGA
GGCCCCTTTTTGGGTCCCCCCAACGGGGTTGGGGGGGCCCAAACCAATTT
TTTTTGTTTAATTAAAAAAACCCCCCCCCCCCGCGGGGGGAGGGATCCCC
GGGAATTCC
Genomic location of TG80  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D498 marker 498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)