SGN Marker TG81

SGN-M499

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG81 image not available
Forward sequence
GGGGGGGGGGTTGACTTTTCAAATATTCATCAGAGTCGATCTATTTAGATTATGAGAAGAAGGCCTCTCTCTCTCTCTCTATATATATAT
ATTGGGTCTTGCTAATTAATATCACAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGCGGTGAAAGATAAAAAGGAGAATGGAGCTACA
GTGAAAGACAAAAAGGAGAATATAGCAACTATGAAAAACAAAAGAAGTCCTCTAATCAATATATTCCTGTATGTTCTTTCAGAGGCATTT
AAGGAAAGTAAATAGTGGTGATAATATATATATATCGCAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGTGGAGAAAGACAAAAAGGA
GAATGGAGCGACATTGAAAGACAAAAAAGGAGTATAGAGCGACAATGAAAAAAAAAGGAGAACAGATCGACAATGTAAGACAAAAAAAGT
CCTCTAATCGATATGTTCTTGTATGTTCTTTTGGGGGCACTTAAAGAGAGTAAATAGTGGCGATAATATA
Reverse sequence
GGGGGGGGGGGGTTTGTCATTTCTAATATTCATCAGAGTCGATCTATTTAGATTATGAGAAGAAGGCCTCTCTCTCTCTCTCTATATATA
TATATTGGGTCTTGCTAATTAATATCACAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGCGGTGAAAGATAAAAAGGAGAATGGAGCT
ACAGTGAAAGACAAAAAGGAGAATATAGCAACTATGAAAAACAAAAGAAGTCCTCTAATCAATATATTCCTGTATGTTCTTTCAGAGGCA
TTTAAGGAAAGTAAATAGTGGTGATAATATATATATATCGCAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGTGGAGAAAGACAAAAA
GGAGAATGGAGCGACATTGAAAGACAAAAAAGGAGTATAGAGCGACAATGAAAAAAAAAGGAGAACAGATCGACAATGTAAGACAAAAAA
AGTCCTCTAATCGATATGTTCTTGTATGTTCTTTTGGGGGCACTTAAAGAGAGTAAATAGTGGCGATAATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9307)
Chromosome
1
Position
51.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9308)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG81 was used as an overgo probe on plate 15 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAATGGCGGTGAAAGATAAAAAG
B sequence
CTGTAGCTCCATTCTCCTTTTTAT
AB sequence
TGAATGGCGGTGAAAGATAAAAAGGAGAAT
Marker sequence
GGGGGGGGGGTTGACTTTTCAAATATTCATCAGAGTCGATCTATTTAGAT
TATGAGAAGAAGGCCTCTCTCTCTCTCTCTATATATATATATTGGGTCTT
GCTAATTAATATCACAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGCG
GTGAAAGATAAAAAGGAGAATGGAGCTACAGTGAAAGACAAAAAGGAGAA
TATAGCAACTATGAAAAACAAAAGAAGTCCTCTAATCAATATATTCCTGT
ATGTTCTTTCAGAGGCATTTAAGGAAAGTAAATAGTGGTGATAATATATA
TATATCGCAAGGAAGTGAATTAAGAAAGGAGAATTGAATGGTGGAGAAAG
ACAAAAAGGAGAATGGAGCGACATTGAAAGACAAAAAAGGAGTATAGAGC
GACAATGAAAAAAAAAGGAGAACAGATCGACAATGTAAGACAAAAAAAGT
CCTCTAATCGATATGTTCTTGTATGTTCTTTTGGGGGCACTTAAAGAGAG
TAAATAGTGGCGATAATATA
Genomic location of TG81  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D499 marker 499
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)