SGN Marker CT175

SGN-M50

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT175 image not available
Forward sequence
TTTTTTTTTTTTTTTTTTTTTTTTTGGATATTCTTTTTTATACTTTTCAAAGTTTTAAGCTTTTTGGAGTCCGTCAATGGCTGGAGTTTT
ATCAGTTCTAAGACGTATTTACCTCACACTTTACAATTGGGTTGTCTTTTTTGGATGGTTTCAAGTTTTTTATTTTGCTGCGAAAACTCT
GAAAGAATCTGGGCATGAACATGTCTATGATGCTGTAAAGAAACCTTTGCTTTTAGCTCAAACCGCGGCCATTTTAGAGATACTTAATGG
TTTAGTGGGTTTGGTAAGATCGCCAGTATCAGCAACGCTTCCACAAATAATTTCAAGATTATATGTAACCTGGGGTATTCT
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1622197.7e-2455 (15.7% of RFLP seq)+
SGN-U1622192.4e-3993 (26.5% of RFLP seq)+
SGN-U1478694.4e-53108 (30.8% of RFLP seq)+
SGN-U1478691.8e-89185 (52.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51869)
Chromosome
4
Position
32.67 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42310)
Chromosome
11
Position
107.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38995)
Chromosome
4
Position
40.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7871)
Chromosome
4
Position
40.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7873)
Chromosome
11
Position
109.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7872)
Chromosome
4
Position
32.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT175 was used as an overgo probe on plate 8 [well A7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGTTTGGTAAGATCGCCAGTATC
B sequence
TTGTGGAAGCGTTGCTGATACTGG
AB sequence
GGGTTTGGTAAGATCGCCAGTATCAGCAAC
Marker sequence
TTTTTTTTTTTTTTTTTTTTTTTTTGGATATTCTTTTTTATACTTTTCAA
AGTTTTAAGCTTTTTGGAGTCCGTCAATGGCTGGAGTTTTATCAGTTCTA
AGACGTATTTACCTCACACTTTACAATTGGGTTGTCTTTTTTGGATGGTT
TCAAGTTTTTTATTTTGCTGCGAAAACTCTGAAAGAATCTGGGCATGAAC
ATGTCTATGATGCTGTAAAGAAACCTTTGCTTTTAGCTCAAACCGCGGCC
ATTTTAGAGATACTTAATGGTTTAGTGGGTTTGGTAAGATCGCCAGTATC
AGCAACGCTTCCACAAATAATTTCAAGATTATATGTAACCTGGGGTATTC
T
Genomic location of CT175  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D50 marker 50
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)