SGN Marker TG82

SGN-M500

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG82 image not available
Forward sequence
ATCTTGTTATTTGTTTCACTGGTTAGCTTTTGCTAGAGGTTTATAGATTAGTTTATTTCTCTAAAGCAAAGATTTTCCACATCTAATCTT
CCTTGTTTTCATTGTGTTAAGTAGCTTTGATATCCATTTAGGCTCCAATGATAAACTTGTGCAATTGCAAAAGTATACTGCCAGAGATCT
TTTATTGTGACAGAGAGGTTTGCAGTATGCAAAAACAACATTTCTTTTGTTATTCTGAGAACTTCCAAAACCACTATTCTTATTTCATTT
GATAAGTTGCAAAAAAAATTATTTTTCCTGTATTGCATATATAACTCTCTTTTTTTCAGGGAATGAATTTTTTGTCTAGCATACAATCTT
CTTCTGTCATTTCCATTTATTATTCATGTTTACCTAGTCCATTGGAGAAATTAAGTTTTAACTTTAATATTCTATTTTCAATTGAACTTC
TACCCATCATGTTCATGAATCATGATTAATCAAATGGATAATAT
Reverse sequence
GGGGGGCGTTACTTCGAAAACATCTTGTTATTTGTTTCACTGGTTAGCTTTTGCTAGAGGTTTATAGATTAGTTTATTTCTCTAAAGCAA
AGATTTTCCACATCTAATCTTCCTTGTTTTCATTGTGTTAAGTAGCTTTGATATCCATTTAGGCTCCAATGATAAACTTGTGCAATTGCA
AAAGTATACTGCCAGAGATCTTTTATTGTGACAGAGAGGTTTGCAGTATGCAAAAACAACATTTCTTTTGTTATTCTGAGAACTTCCAAA
ACCACTATTCTTATTTCATTTGATAAGTTGCAAAAAAAATTATTTTTCCTGTATTGCATATATAACTCTCTTTTTTTCAGGGAATGAATT
TTTTGTCTAGCATACAATCTTCTTCTGTCATTTCCATTTATTATTCATGTTTACCTAGTCCATTGGAGAAATTAAGTTTTAACTTTAATA
TTCTATTTTCAATTGAACTTCTACCCATCATGTTCATGAATCATGATTAATCAAATGGATAATA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9309)
Chromosome
1
Position
26.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG82 was used as an overgo probe on plate 14 [well E1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P112A18,   P004L01,   P223M12,   P112A17,   P234J24,   P112C18,   P010N24,   P100M24

 Overgo Sequences

A sequence
TACTGCCAGAGATCTTTTATTGTG
B sequence
CTGCAAACCTCTCTGTCACAATAA
AB sequence
TACTGCCAGAGATCTTTTATTGTGACAGAG
Marker sequence
ATCTTGTTATTTGTTTCACTGGTTAGCTTTTGCTAGAGGTTTATAGATTA
GTTTATTTCTCTAAAGCAAAGATTTTCCACATCTAATCTTCCTTGTTTTC
ATTGTGTTAAGTAGCTTTGATATCCATTTAGGCTCCAATGATAAACTTGT
GCAATTGCAAAAGTATACTGCCAGAGATCTTTTATTGTGACAGAGAGGTT
TGCAGTATGCAAAAACAACATTTCTTTTGTTATTCTGAGAACTTCCAAAA
CCACTATTCTTATTTCATTTGATAAGTTGCAAAAAAAATTATTTTTCCTG
TATTGCATATATAACTCTCTTTTTTTCAGGGAATGAATTTTTTGTCTAGC
ATACAATCTTCTTCTGTCATTTCCATTTATTATTCATGTTTACCTAGTCC
ATTGGAGAAATTAAGTTTTAACTTTAATATTCTATTTTCAATTGAACTTC
TACCCATCATGTTCATGAATCATGATTAATCAAATGGATAATAT
Genomic location of TG82  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D500 marker 500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)