SGN Marker CT80

SGN-M501

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT80 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTAAGAAATGAAACAACATATTCTCTTGGCACTATTTCTTTTGGACATTACAAATATTTGGAAATTTT
AAAAGCCAGAAAGGCTACTTAAGTACTTCCTTGCCAGACAAGATCCAATGATCTACAATACCAAGTGCAGAATTAAGTACAACCATCATT
TTTTGGCCTAAACTGAATTAAACTCGTCAAGAAGAAAAAAAATTCCTTCCATCCGAACAAAAGAAACAAACCGGGAAATGTACAGCAGTT
GTGATGCATACTGCAAGTTTACTCCTGGTACTTCATCTCGGACATCTTGAACCCAGGCATGTCAAAAGAGGCTGAGAATTTCTCGACATC
AACCTTAAGTTCTTCAATTTCCTTGTTGTTAACGAGACCCTTGTTGAAGTCCTTCAAAAGCTTTCCGAACTCCTTCTGGATGTTCAAGGT
GATTGTAACAGCCCTGTGGAGGAACTCCGCGATCTGCTCAAAGTCCTTCTCAACCA
Reverse sequence
GACAAATGGGTATATTGATTACGATAGGTTGGAAGAGAAGGCTTTGGATTTTAGGCCAAAATTGATTATCTGTGGAGGAAGTGCTTACCC
AAGAGATTGGGATTACAAGAGGTTCAGAGAGGTTGCTGACAAATGTGGGGCTCTTTTGCTTTGTGATATGGCTCACATTAGTGGTCTTGT
TGCTGCTCAGGAAGCAGCGAATCCCTTTGAATATTGTGACTTGGTTACTACCACCACACACAAGAGTTTGAGGGGTCCAAGAGCTGGTAT
GATTTTCTACCGCAAGGGCCCTAAGCCACCAAAGAAGGGCCAGCCTGAAGATGCAGTTTATGACTTTGAAGACAAGATTAACTTTGCTGT
TTTCCCCTCTCTCCAGGGTGGTCCTCACAACCACCAAATCGGCGCTCTTGCTGTTGCCCTGAAACAGGCTGCGACTCCTGGATTCAAGGC
TTATGCTAAGCAAGTGAAGGCCAATGCAGTTGCTCTCGGTGACTACCTGATGAGCAAAGGATACAAACTTGTAACTGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1607396e-1036 (7.1% of RFLP seq)+
SGN-U1437432.3e-43216 (42.7% of RFLP seq)+
SGN-U1607389.8e-49113 (22.3% of RFLP seq)+
SGN-U1607392.9e-61142 (28.1% of RFLP seq)+
SGN-U1607383e-138255 (50.4% of RFLP seq)+
SGN-U143742482 (95.3% of RFLP seq)+
SGN-U1631299.4e-0629 (5.5% of RFLP seq)-
SGN-U1511593.9e-0897 (18.4% of RFLP seq)-
SGN-U1437439.8e-0954 (10.2% of RFLP seq)-
SGN-U1511703.7e-42185 (35.0% of RFLP seq)-
SGN-U143742528 (100.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53478)
Chromosome
12
Position
76.85 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51906)
Chromosome
5
Position
43.49 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39071)
Chromosome
5
Position
103.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39072)
Chromosome
12
Position
102.50 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9310)
Chromosome
5
Position
75.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9311)
Chromosome
12
Position
79.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9316)
Chromosome
5
Position
41.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT80 was used as an overgo probe on plate 5 [well D9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTTACTCCTGGTACTTCATCTCG
B sequence
CTGGGTTCAAGATGTCCGAGATGA
AB sequence
GTTTACTCCTGGTACTTCATCTCGGACATC
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTAAGAAATGAAACAACATATTCTCTTG
GCACTATTTCTTTTGGACATTACAAATATTTGGAAATTTTAAAAGCCAGA
AAGGCTACTTAAGTACTTCCTTGCCAGACAAGATCCAATGATCTACAATA
CCAAGTGCAGAATTAAGTACAACCATCATTTTTTGGCCTAAACTGAATTA
AACTCGTCAAGAAGAAAAAAAATTCCTTCCATCCGAACAAAAGAAACAAA
CCGGGAAATGTACAGCAGTTGTGATGCATACTGCAAGTTTACTCCTGGTA
CTTCATCTCGGACATCTTGAACCCAGGCATGTCAAAAGAGGCTGAGAATT
TCTCGACATCAACCTTAAGTTCTTCAATTTCCTTGTTGTTAACGAGACCC
TTGTTGAAGTCCTTCAAAAGCTTTCCGAACTCCTTCTGGATGTTCAAGGT
GATTGTAACAGCCCTGTGGAGGAACTCCGCGATCTGCTCAAAGTCCTTCT
CAACCA
Genomic location of CT80  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D501 marker 501
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)