SGN Marker CT81

SGN-M504

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
350
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT81 image not available
Forward sequence
CGATCTCCATAACTGCTGCTGCTGTTATTATGCTTTTCGTCGTCTCAGAGGGGGAGAGACGCACAACGAACGCAAAAAACAAAATAATAT
CGAAACTAGAAGAGTAATTCGAAAAAAAATATATTTTTATCATATATTTATATAATTCGAAGTCATGAATTTGTTGTGTGAAAAATTCAT
CCCCTTCTCTGAATTGTTATTTTGAAGAATTAAATCCTTTTTAATTTTTTTTTTTCCAGTGTTCTACAGAAAGATTGTGGCTTTACAGTT
TCTTTTAAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTAAAAGAAACTGTAAAGCCACAATCTTTCTGTAGAACACTGGAAAAAAAAAAATTAAAAAGGATTTAATTCTTCAAA
ATAACAATTCAGAGAAGGGGATGAATTTTTCACACAACAAATTCATGACTTCGAATTATATAAATATATGATAAAAATATATTTTTTTTC
GAATTACTCTTCTAGTTTTGATATTATTTTGTTTTTTGCGTTCGTTGTGCGTCTCTCCCCCTCTGAGACGACGAAAAGCATAATAACAGC
AGCAGCAGTTATGGAGATCG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1438952e-119276 (95.2% of RFLP seq)+
SGN-U1438959e-122276 (95.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39073)
Chromosome
1
Position
47.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9317)
Chromosome
1
Position
75.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9318)
Chromosome
1
Position
35.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT81 was used as an overgo probe on plate 14 [well B9]

Plausible BAC Matches:   P104D02,   P060J24,   P211P06,   P168G04,   P072A06,   P079M24

 Overgo Sequences

A sequence
CTCCATAACTGCTGCTGCTGTTAT
B sequence
GACGACGAAAAGCATAATAACAGC
AB sequence
CTCCATAACTGCTGCTGCTGTTATTATGCT
Marker sequence
CGATCTCCATAACTGCTGCTGCTGTTATTATGCTTTTCGTCGTCTCAGAG
GGGGAGAGACGCACAACGAACGCAAAAAACAAAATAATATCGAAACTAGA
AGAGTAATTCGAAAAAAAATATATTTTTATCATATATTTATATAATTCGA
AGTCATGAATTTGTTGTGTGAAAAATTCATCCCCTTCTCTGAATTGTTAT
TTTGAAGAATTAAATCCTTTTTAATTTTTTTTTTTCCAGTGTTCTACAGA
AAGATTGTGGCTTTACAGTTTCTTTTAAAAAAAAAAAAAA
Genomic location of CT81  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D504 marker 504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)