SGN Marker TG86

SGN-M507

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG86 image not available
Forward sequence
GGGGGGGTTTACTTTTTCGCCTATTTTTGTTATAAAGAGGACCAAGCCTGTCATGCTCTCGTTGTAATTAAAACTGTATACAAACTGGCA
TGATCTCGTTGTAAATATTGGTGAGGTTTAATCACACAAAAAATGTCTGAGCTTGATTAACACAATTTGTGGCAGGCTGCCCTTGAAAAG
GGTAAGAATCCAGAGAACGATGAGGTCTCATCTGCTGAAAATTCAGTTGATGGTCCAGATCAGGTCGAGTCAGTTATGTCCCAGATAAAC
AATCTTGCCATATCTGCAAATCCTGTTGTCCCTCCTTCAAATTCAACCGAGTCTTCTGGCATGGGAGATAGTCTGCAGGACATTGACAAA
AAGATCCGAGCTCTGAAGAAAAAGGTATGTACTCTTGTGCTTCTAGTTCTCTGATGGTATGCCATCATTCAAGAGCTATCAAGTAAGTTT
GATGCATCTTAAAGCATTTTAGAAATACTCAGCTATTTCTACTTTGCGTTGTATGGTCAAAATACTCTCTATT
Reverse sequence
GGGGGGGTTTACTTTTTCCCTATTTTTGTTATAAAGAGGACCAAGCCTGTCATGCTCTCGTTGTAATTAAAACTGTATACAAACTGGCAT
GATCTCGTTGTAAATATTGGTGAGGTTTAATCACACAAAAAATGTCTGAGCTTGATTAACACAATTTGTGGCAGGCTGCCCTTGAAAAGG
GTAAGAATCCAGAGAACGATGAGGTCTCATCTGCTGAAAATTCAGTTGATGGTCCAGATCAGGTCGAGTCAGTTATGTCCCAGATAAACA
ATCTTGCCATATCTGCAAATCCTGTTGTCCCTCCTTCAAATTCAACCGAGTCTTCTGGCATGGGAGATAGTCTGCAGGACATTGACAAAA
AGATCCGAGCTCTGAAGAAAAAGGTATGTACTCTTGTGCTTCTAGTTCTCTGATGGTATGCCATCATTCAAGAGCTATCAAGTAAGTTTG
ATGCATCTTAAAGCATTTTAGAAATACTCAGCTATTTCTACTTTGCGTTGTATGGTCAAAATACTCTCTAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1458737.2e-59134 (25.6% of RFLP seq)+
SGN-U1458743e-123222 (42.4% of RFLP seq)+
SGN-U161668516 (98.7% of RFLP seq)+
SGN-U1458737.2e-59134 (25.7% of RFLP seq)-
SGN-U1458743e-123222 (42.6% of RFLP seq)-
SGN-U161668515 (98.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9325)
Chromosome
1
Position
76.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG86 was used as an overgo probe on plate 3 [well E12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P113H15,   P102E03,   P332I19,   P175M19,   P058I13,   P217P11,   P163C12

 Overgo Sequences

A sequence
TCAGTTGATGGTCCAGATCAGGTC
B sequence
GGGACATAACTGACTCGACCTGAT
AB sequence
TCAGTTGATGGTCCAGATCAGGTCGAGTCA
Marker sequence
GGGGGGGTTTACTTTTTCGCCTATTTTTGTTATAAAGAGGACCAAGCCTG
TCATGCTCTCGTTGTAATTAAAACTGTATACAAACTGGCATGATCTCGTT
GTAAATATTGGTGAGGTTTAATCACACAAAAAATGTCTGAGCTTGATTAA
CACAATTTGTGGCAGGCTGCCCTTGAAAAGGGTAAGAATCCAGAGAACGA
TGAGGTCTCATCTGCTGAAAATTCAGTTGATGGTCCAGATCAGGTCGAGT
CAGTTATGTCCCAGATAAACAATCTTGCCATATCTGCAAATCCTGTTGTC
CCTCCTTCAAATTCAACCGAGTCTTCTGGCATGGGAGATAGTCTGCAGGA
CATTGACAAAAAGATCCGAGCTCTGAAGAAAAAGGTATGTACTCTTGTGC
TTCTAGTTCTCTGATGGTATGCCATCATTCAAGAGCTATCAAGTAAGTTT
GATGCATCTTAAAGCATTTTAGAAATACTCAGCTATTTCTACTTTGCGTT
GTATGGTCAAAATACTCTCTATT
Genomic location of TG86  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D507 marker 507
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)