SGN Marker CT140

SGN-M508

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
AACAATGAGGAGATTAGAAAAGTTGAAAAAGAACACAAGGCTAGAGTTGTTCGGGAAAGGAAGGAACGTCGTAGACAATGGGCTCAAAAG
TTAACTCCACGACCTAAACAAAATGATGAAAGCATTGAAGACACAAAAGAACCTGAAGATGCCCAAGAGTCAAAGGACAATAGAGGGATG
CTGCCTGATGAGATTGTAAAAATTCTTGCAGCTCGTGAAAAGAAAGTTTTCTCGTCAGACTCGGAAGAAGAACATGAGAAGCAGCCTACA
TCTAAAAACAAAAGATCCAAGAGCTCTGGGTCTGGACCAGTTATTTTGAAGGATCTACCACCTCCTCCGTGCTTAGAGAGCTCACTGGCA
TTCTTGAAGAAACGTAAGATGCAGGTGTCAAGATCATCAGCTGTTCTGAACAATTCCAGTCAAGCATTACGCCTTCTATCTACATCTGGC
TTGCTACGTACGAAATTATAGGTGATGATTTTGAAG
Reverse sequence
TTTTTTTTTTTTATCAATAAAATTGCAATATACCATCAAAAAGTTGTTACAATGTTTTGTTTTGTTTTTTTGGTTTACCCATCAGTGTCC
AAAACCAGCTCGCCATTTAACACCTCTACCAGCATATTCTCATTACAGCAAGCAATACAGCATTGACATCACTCGGGCTAAAATCTTCAA
AATCATCACCTATAATTTCGTACGTAGCAAGCCAGATGTAGATAGAAGGCGTAATGCTTGACTGGAATTGTTCAGAACAGCTGATGATCT
TGACACCTGCATCTTACGTTTCTTCAAGAATGCCAGTGAGCTCTCTAAGCACGGAGGAGGTGGTAGATCCTTCAAAATAACTGGTCCAGA
CCCAGAGCTCTTGGATCTTTTGTTTTTAGATGTAGGCTGCTTCTCATGTTCTTCTTCCGAGTCTGACGAGAAAACTTTCTTTTCACGAGC
TGCAAGAATTTTTACAATCTCATCAGGCAGCATCCCTCTATTGTCCTTTGACTCTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U149948486 (100.0% of RFLP seq)+
SGN-U1499484e-1439 (7.7% of RFLP seq)-
SGN-U149948431 (85.0% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49318)
Chromosome
2
Position
31.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47256)
Chromosome
2
Position
19.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38975)
Chromosome
2
Position
16.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9326)
Chromosome
2
Position
18.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT140 was used as an overgo probe on plate 15 [well H11]

Plausible BAC Matches:   P163K16,   P156O14,   P292L19

 Overgo Sequences

A sequence
GAACACAAGGCTAGAGTTGTTCGG
B sequence
GACGTTCCTTCCTTTCCCGAACAA
AB sequence
GAACACAAGGCTAGAGTTGTTCGGGAAAGG
Marker sequence
AACAATGAGGAGATTAGAAAAGTTGAAAAAGAACACAAGGCTAGAGTTGT
TCGGGAAAGGAAGGAACGTCGTAGACAATGGGCTCAAAAGTTAACTCCAC
GACCTAAACAAAATGATGAAAGCATTGAAGACACAAAAGAACCTGAAGAT
GCCCAAGAGTCAAAGGACAATAGAGGGATGCTGCCTGATGAGATTGTAAA
AATTCTTGCAGCTCGTGAAAAGAAAGTTTTCTCGTCAGACTCGGAAGAAG
AACATGAGAAGCAGCCTACATCTAAAAACAAAAGATCCAAGAGCTCTGGG
TCTGGACCAGTTATTTTGAAGGATCTACCACCTCCTCCGTGCTTAGAGAG
CTCACTGGCATTCTTGAAGAAACGTAAGATGCAGGTGTCAAGATCATCAG
CTGTTCTGAACAATTCCAGTCAAGCATTACGCCTTCTATCTACATCTGGC
TTGCTACGTACGAAATTATAGGTGATGATTTTGAAG
Genomic location of CT140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D508 marker 508
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)