SGN Marker CT154

SGN-M51

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTGAACGCGAAAGAGTGCTGATAGCTCAGACCTCATATTCAAGACAATGTTTCGATGATCGCATCAAAGGCTTAGATGC
AGGATAATTCCAACATTCACAAGGACCAGACGTTCATCATTCCAAGTATTACAAAGAAAGATTTAATACGAAGTTACTTGGCTGATACAG
ATCCAACCACATACATACAGTTTATAAGTGGCTCAAAGATGGCCAATTGTGAAATGAAATGGAAATTCAGAAGGTAGATCCATTCCAGCC
AAAGAAGGAACCATGATCTAGTACTGGTGTATAGCATGAAGACATTGTGCATATTCTTGACTTTGATGGGCCTTAGTATCATAGAATTTC
AGGAAAAATCGAGATTTGGGAATAGACAATTTAGTCTCAAGTATGTCAGCTATTGCAGCACTGAGTTTCTTGTTGACATCAGCATTTAAA
CCCCCAATGGAGACCAACTCTCCATAGGCAGCGGGCTGTTCTGTACCCCCGAAAGCCATGGGAACAGATCCCTTCAAC
Reverse sequence
TTTGAATTCCTTTTTTTACAGTGACTCGAGAACAGCCAAGGAAGAAGAAGAAGAAAATGCCGTGCCTTAACATTTCTACAAATGTGAACT
TGGAAGGAGTTGATACTTCCTCCGTACTTTCTGAAGCTACCTCCACTGTTGCCAAACTCATCGGCAAACCAGAAGCTTATGTCATGATTG
TGTTGAAGGGATCTGTTCCCATGGCTTTCGGGGGTACAGAACAGCCCGCTGCCTATGGAGAGTTGGTCTCCATTGGGGGTTTAAATGCTG
ATGTCAACAAGAAACTCAGTGCTGCAATAGCTGACATACTTGAGACTAAATTGTCTATTCCCAAATCTCGATTTTTCCTGAAATTCTATG
ATACTAAGGCCCATCAAAGTCAAGAATATGCACAATGTCTTCATGCTATACACCAGTACTAGATCATGGCTCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1612971.2e-60117 (22.2% of RFLP seq)+
SGN-U1449185e-103188 (35.6% of RFLP seq)+
SGN-U1449189e-151268 (50.8% of RFLP seq)+
SGN-U1612972e-132281 (64.9% of RFLP seq)-
SGN-U144918352 (81.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7877)
Chromosome
10
Position
33.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT154 was used as an overgo probe on plate 15 [well F4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCATTCCAGCCAAAGAAGGAACCA
B sequence
CACCAGTACTAGATCATGGTTCCT
AB sequence
CCATTCCAGCCAAAGAAGGAACCATGATCT
Marker sequence
TTTTTTTTTTTTTGAACGCGAAAGAGTGCTGATAGCTCAGACCTCATATT
CAAGACAATGTTTCGATGATCGCATCAAAGGCTTAGATGCAGGATAATTC
CAACATTCACAAGGACCAGACGTTCATCATTCCAAGTATTACAAAGAAAG
ATTTAATACGAAGTTACTTGGCTGATACAGATCCAACCACATACATACAG
TTTATAAGTGGCTCAAAGATGGCCAATTGTGAAATGAAATGGAAATTCAG
AAGGTAGATCCATTCCAGCCAAAGAAGGAACCATGATCTAGTACTGGTGT
ATAGCATGAAGACATTGTGCATATTCTTGACTTTGATGGGCCTTAGTATC
ATAGAATTTCAGGAAAAATCGAGATTTGGGAATAGACAATTTAGTCTCAA
GTATGTCAGCTATTGCAGCACTGAGTTTCTTGTTGACATCAGCATTTAAA
CCCCCAATGGAGACCAACTCTCCATAGGCAGCGGGCTGTTCTGTACCCCC
GAAAGCCATGGGAACAGATCCCTTCAAC
Genomic location of CT154  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D51 marker 51
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)