SGN Marker CT213

SGN-M510

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT213 image not available
Forward sequence
TACATTTCTTGTTTCTCCCACTCTCTGATTCAACAGCTTCATGCATGAAGAGGGTAGCAATATAGGTGAAGATGTGGCATTATGTTTGAC
TCATTTCATCTTGGAACATCGTTTGTCTAGATTATGACCACGATGAGGAAACCAGGAGCCATATGAGAAGATGTGCTATTGGCAGTTTGC
TTGTACCAAGTTTCGTAGAACTGTATAAATTGCTACTTGGTGGTTTTATGTTGATGGCCCAGGTTCAGAGTTTGATCACTACATGACCCT
CACCTTTTAGTGGCTAAACTATCTGTTATCTGGTTGTCCCTAGTTTTAAGAAAGTGTAGTTTTATTGAGATGCCTGCTCCTCAGCAGAAT
CCCTGCTCTTCTTTTGTGTGTACTTTACTCATGTGTTCTTCGTATTAGTGAAAGCCAGTTGGTTGTGTGTTCTCTCTAAAAAAAAAAAAA
AAAAA
Reverse sequence
TTTTTTTTTTTTTTTTTTAGAGAGAACACACAACCAACTGGCTTTCACTAATACGAAGAACACATGAGTAAAGTACACACAAAAGAAGAG
CAGGGATTCTGCTGAGGAGCAGGCATCTCAATAAAACTACACTTTCTTAAAACTAGGGACAACCAGATAACAGATAGTTTAGCCACTAAA
AGGTGAGGGTCATGTAGTGATCAAACTCTGAACCTGGGCCATCAACATAAAACCACCAAGTAGCAATTTATACAGTTCTACGAAACTTGG
TACAAGCAAACTGCCAATAGCACATCTTCTCATATGGCTCCTGGTTTCCTCATCGTGGTCATAATCTAGACAAACGATGTTCCAAGATGA
AATGAGTCAAACATAATGCCACATCTTCACCTATATTGCTACCCTCTTCATGCATGAAGCTGTTGAATCAGAGAGTGGGAGAAACAAGAA
ATGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1602661e-171311 (68.4% of RFLP seq)+
SGN-U1602661e-171311 (68.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39018)
Chromosome
2
Position
24.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9335)
Chromosome
2
Position
18.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9336)
Chromosome
2
Position
25.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT213 was used as an overgo probe on plate 16 [well C6]

Plausible BAC Matches:   P146O12,   P113D21,   P168O11,   P225A16

 Overgo Sequences

A sequence
CTCCCACTCTCTGATTCAACAGCT
B sequence
CCCTCTTCATGCATGAAGCTGTTG
AB sequence
CTCCCACTCTCTGATTCAACAGCTTCATGC
Marker sequence
TACATTTCTTGTTTCTCCCACTCTCTGATTCAACAGCTTCATGCATGAAG
AGGGTAGCAATATAGGTGAAGATGTGGCATTATGTTTGACTCATTTCATC
TTGGAACATCGTTTGTCTAGATTATGACCACGATGAGGAAACCAGGAGCC
ATATGAGAAGATGTGCTATTGGCAGTTTGCTTGTACCAAGTTTCGTAGAA
CTGTATAAATTGCTACTTGGTGGTTTTATGTTGATGGCCCAGGTTCAGAG
TTTGATCACTACATGACCCTCACCTTTTAGTGGCTAAACTATCTGTTATC
TGGTTGTCCCTAGTTTTAAGAAAGTGTAGTTTTATTGAGATGCCTGCTCC
TCAGCAGAATCCCTGCTCTTCTTTTGTGTGTACTTTACTCATGTGTTCTT
CGTATTAGTGAAAGCCAGTTGGTTGTGTGTTCTCTCTAAAAAAAAAAAAA
AAAAA
Genomic location of CT213  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D510 marker 510
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)