SGN Marker TG87

SGN-M511

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG87 image not available
Forward sequence
GGTATTCTTCGTTCTAAATTTACATAAACTTTTTTTTATAGATCAAGAATTTAAATATGGAGAATCTATCATTGAAGAAAATACGGATTG
AGTTGAAGTTCAAGGGAGATTTTACTTTGGTTAGGTGGTTTAAAGATGATATCTTAATAATTATAAATGTTGTATTTTTTTAAATGTTGT
ATTTTTTTTGCTTAATAGTTGATAAAGATTTGTCATACAACTTGAATAGATAGAGTATATCTTTCCTGAATAACCTTAACACCTATCATG
ACTGAAGTATCAGTTTTAGTGAAGAGGCTTAGGTAGGCTATCCTACACAATTCAACACCTTCAAAAGTCTCCACAGATTGCGAAGAGATT
ATCAAATACCTAAAAGATGATCATCCACCATACTCTAATATATTATTGGAAAAAGGATTAAAAATACCCCTTAACATTATTTTATTAGTT
ATTTATGCCTTTGCCGTTAAAAGAAAGTTATTTTTATCCCTGCAGTTATTATTTCATCATTTATACCCCTCATTTAACAGAAATCCCCAA
ATTG
Reverse sequence
TCTTTGTTACTAAATTTACATAAACTTTTTTTTATAGATCAAGAATTTAAATATGGAGAATCTATCATTGAAGAAAATACGGATTGAGTT
GAAGTTCAAGGGAGATTTTACTTTGGTTAGGGGGTTTAAAGATGATATCTTAATAATTATAGATGTTGTATTTTTTTAAATGTTGTATTT
TTTTTGCTTAATAGTTGATAAAGATTTGTCATACAACTTGAATAGATAGAGTATATCTTTCCTGAATAACCTTAACACCTATCATGACTG
AAGTATCACTTTTAGTGAAGAGGCTTAGGTAGGCTATCCTACACAATTCAACACCTTCAGAAGTCTCCACAGATTGCGAAGAGATTATCA
AATACCTAAAAGATGATCATCCACCATACTCTAATATATTATTGGAAAAAGGATTAAAAATACCCCTTAACATTATTTTATTAGTTATTT
ATGCCTTTGCCGTTAAAAGAAAGTTATTTTTATCCCTGCAGTTATTATTTCATCATTTATACCCCTCATTTAACAGAAATCCCCAAATTG
ACTCAAATTAACCC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9338)
Chromosome
1
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG87 was used as an overgo probe on plate 14 [well D1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P267D10,   P090M19,   P249A01,   P330A24,   P116G13,   P266C12,   P196K21,   P266D10,   P021I05,   P071A12,   P219K16,   P289E10,   P197J12,   P295F18,   P012E09,   P327D08,   P161F08,   P160N13,   P102E15,   P267C12

 Overgo Sequences

A sequence
GTGAAGAGGCTTAGGTAGGCTATC
B sequence
GTGTTGAATTGTGTAGGATAGCCT
AB sequence
GTGAAGAGGCTTAGGTAGGCTATCCTACAC
Marker sequence
GGTATTCTTCGTTCTAAATTTACATAAACTTTTTTTTATAGATCAAGAAT
TTAAATATGGAGAATCTATCATTGAAGAAAATACGGATTGAGTTGAAGTT
CAAGGGAGATTTTACTTTGGTTAGGTGGTTTAAAGATGATATCTTAATAA
TTATAAATGTTGTATTTTTTTAAATGTTGTATTTTTTTTGCTTAATAGTT
GATAAAGATTTGTCATACAACTTGAATAGATAGAGTATATCTTTCCTGAA
TAACCTTAACACCTATCATGACTGAAGTATCAGTTTTAGTGAAGAGGCTT
AGGTAGGCTATCCTACACAATTCAACACCTTCAAAAGTCTCCACAGATTG
CGAAGAGATTATCAAATACCTAAAAGATGATCATCCACCATACTCTAATA
TATTATTGGAAAAAGGATTAAAAATACCCCTTAACATTATTTTATTAGTT
ATTTATGCCTTTGCCGTTAAAAGAAAGTTATTTTTATCCCTGCAGTTATT
ATTTCATCATTTATACCCCTCATTTAACAGAAATCCCCAAATTG
Genomic location of TG87  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D511 marker 511
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)