SGN Marker CT214

SGN-M512

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT214 image not available
Forward sequence
CTTTTTTTACAGTGACTCGAGAACAGCCAAGGAAGAAGAAGAAGAAAATGCCGTGCCTTAACATTTCTACAAATGTGAACTTGGAAGGAG
TTGATACTTCCTCCGTACTTTCTGAAGCTACCTCCACTGTTGCCAAACTCATCGGCAAACCAGAAGCTTATGTCATGATTGTGTTGAAGG
GATCTGTTCCCATGGCTTTCGGGGGTACAGAACAGCCCGCTGCCTATGGAGAGTTGGTCTCCATTGGGGGTTTAAATGCTGATGTCAACA
AGAAACTCAGTGCTGCAATAGCTGACATACTTGAGACTAAATTGTCTATTCCCAAATCTCGATTTTTCCTGAAATTCTATGATACTAAGG
CCCATCAAAGTCAAGAATATGCACAATGTCTTCATGCTATACACCAGTACTAGATCATGGTTCCTTCTTTGGCTGGAATGGATCTACCTT
CTGAATTTCCATTTCATTTCACAATTGGCCATCTTTGAGCCACTTATAAACTGT
Reverse sequence
TTTTTTTTTTTTTGAACGCGAAAGAGTGCTGATAGCTCAGACCTCATATTCAAGACAATGTTTCGATGATCGCATCAAAGGCTTAGATGC
AGGATAATTCCAACATTCACAAGGACCAGACGTTCATCATTCCAAGTATTACAAAGAAAGATTTAATACGAAGTTACTTGGCTGATACAG
ATCCAACCACATACATACAGTTTATAAGTGGCTCAAAGATGGCCAATTGTGAAATGAAATGGAAATTCAGAAGGTAGATCCATTCCAGCC
AAAGAAGGAACCATGATCTAGTACTGGTGTATAGCATGAAGACATTGTGCATATTCTTGACTTTGATGGGCCTTAGTATCATAGAATTTC
AGGAAAAATCGAGATTTGGGAATAGACAATTTAGTCTCAAGTATGTCAGCTATTGCAGCACTGAGTTTCTTGTTGACATCAGCATTTAAA
CCCCCAATGGAGACCAACTCTCCATAGGCAGCGGGCTGTTCTGTACCCCCGAAAGCCATGGGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1449183.6e-4286 (17.1% of RFLP seq)+
SGN-U1612973e-132281 (55.8% of RFLP seq)+
SGN-U144918352 (69.8% of RFLP seq)+
SGN-U1612971e-51102 (19.9% of RFLP seq)-
SGN-U1449184.4e-94173 (33.7% of RFLP seq)-
SGN-U1449189e-151268 (52.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51881)
Chromosome
8
Position
85.38 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51880)
Chromosome
10
Position
57.50 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9339)
Chromosome
10
Position
33.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9340)
Chromosome
8
Position
23.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9341)
Chromosome
10
Position
15.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT214 was used as an overgo probe on plate 15 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCTCCGTACTTTCTGAAGCTACC
B sequence
GTTTGGCAACAGTGGAGGTAGCTT
AB sequence
TCCTCCGTACTTTCTGAAGCTACCTCCACT
Marker sequence
CTTTTTTTACAGTGACTCGAGAACAGCCAAGGAAGAAGAAGAAGAAAATG
CCGTGCCTTAACATTTCTACAAATGTGAACTTGGAAGGAGTTGATACTTC
CTCCGTACTTTCTGAAGCTACCTCCACTGTTGCCAAACTCATCGGCAAAC
CAGAAGCTTATGTCATGATTGTGTTGAAGGGATCTGTTCCCATGGCTTTC
GGGGGTACAGAACAGCCCGCTGCCTATGGAGAGTTGGTCTCCATTGGGGG
TTTAAATGCTGATGTCAACAAGAAACTCAGTGCTGCAATAGCTGACATAC
TTGAGACTAAATTGTCTATTCCCAAATCTCGATTTTTCCTGAAATTCTAT
GATACTAAGGCCCATCAAAGTCAAGAATATGCACAATGTCTTCATGCTAT
ACACCAGTACTAGATCATGGTTCCTTCTTTGGCTGGAATGGATCTACCTT
CTGAATTTCCATTTCATTTCACAATTGGCCATCTTTGAGCCACTTATAAA
CTGT
Genomic location of CT214  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D512 marker 512
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)