SGN Marker CT216

SGN-M516

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT216 image not available
Forward sequence
CTTTTTTTTTTTTTCAAACAACACCAAAAAAAAGTTGAGTATTCACAGCTTAAGTTTTCTTTCAATTGCTATAAAAAAAAACAATGGTCT
TTCTATTACTTATAATTACTGCTACAAATTCAACAAAATGACACTAAAAATGTATTGAATTTCATATCAAAGCCTTCTCTATTTACATAT
TCCCAACAAAATGGCATCTTTTCTCTATGCCATATAGGCCGCTCTCTTATCCATCAATCTTCTACTTCTAGTCGACTGCTCTAGAACCAA
ACTTTCTCTTTTTTTAGTGCTCCCTTCCCACTCAACAGGTAATAATTTAAAGAACGACATTATTGTCTTCTTCTTCTAATCGACTGCTCT
ACCAATCACACATTGCCTTACACTTGGCATCGGGGGATATCGTCTTCTGCTTCTAGTCGACTGCTCTATAAAAATAATAATTGAATATTG
GCGGTTTCCGACTAAGGAATTACCATCTTGTTACTCCATTACGTTCT
Reverse sequence
TTTTTTTTTCTCTTAGGAAACCTTTTTTATATTCTCCGGCGAGCCAAATCGGAGCATAATTTGGGGGTTTTGAGTTATTGGATCTAACCG
GGTTTATTGGGTTGAGTTTTGACTGATCTCCGGCGACTGCAGATGTCTTCGTACTGGTGTTATCGGTGTACAAGGTTTGTTAGAATTTCA
GTTGGAAACGATGTTGTTTGTCCTCACTGTGATAGTGGATTTATAGAAGTTGCTGAGGGAAATATTGGGTCGCCGGAATCTCGCCGGAGG
TTTCCCATGTGGAACGAACGGCCAGAGTCAGATCGGAGTGTGAACATGGGTTCTCGACGGAGCAGGCGTAATCGGGGTGATAGATCTCCG
TTTAATCCGGTTATTGTTCTTCGTAGTCCATCTGAAGCACCTGGGGAGGATGAAGCTGCTGCAGCTGCAGAGGAGCGGAGTTATGAGCTT
TATTATGATGATGGTGAAGGTTCAGGTCTCAGGCCGTTGCCGCCGACGATGTCGGAGTTTTTGATGGGAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1613639.2e-0930 (6.0% of RFLP seq)+
SGN-U1613651.8e-25119 (23.9% of RFLP seq)+
SGN-U1613652.8e-61134 (27.0% of RFLP seq)+
SGN-U1613665.7e-81224 (45.1% of RFLP seq)+
SGN-U1613644.4e-97350 (70.4% of RFLP seq)+
SGN-U145067416 (83.7% of RFLP seq)+
SGN-U1613631.8e-96177 (34.0% of RFLP seq)-
SGN-U145067511 (98.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53460)
Chromosome
6
Position
2.62 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43647)
Chromosome
6
Position
12.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43047)
Chromosome
6
Position
12.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42958)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43958
Forward primer (5'-3')
GAGCCAAATCGGAGCATAAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CAACGGCCTGAGACCTGAACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42327)
Chromosome
6
Position
34.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40750)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39019)
Chromosome
6
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9345)
Chromosome
6
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9348)
Chromosome
6
Position
40.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9347)
Chromosome
6
Position
7.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9346)
Chromosome
6
Position
10.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9352)
Chromosome
6
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT216 was used as an overgo probe on plate 1 [well A6]

Plausible BAC Matches:   P147H20

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTGCTCTACCAATCACACATTGCC
B sequence
CCGATGCCAAGTGTAAGGCAATGT
AB sequence
CTGCTCTACCAATCACACATTGCCTTACAC
Marker sequence
CTTTTTTTTTTTTTCAAACAACACCAAAAAAAAGTTGAGTATTCACAGCT
TAAGTTTTCTTTCAATTGCTATAAAAAAAAACAATGGTCTTTCTATTACT
TATAATTACTGCTACAAATTCAACAAAATGACACTAAAAATGTATTGAAT
TTCATATCAAAGCCTTCTCTATTTACATATTCCCAACAAAATGGCATCTT
TTCTCTATGCCATATAGGCCGCTCTCTTATCCATCAATCTTCTACTTCTA
GTCGACTGCTCTAGAACCAAACTTTCTCTTTTTTTAGTGCTCCCTTCCCA
CTCAACAGGTAATAATTTAAAGAACGACATTATTGTCTTCTTCTTCTAAT
CGACTGCTCTACCAATCACACATTGCCTTACACTTGGCATCGGGGGATAT
CGTCTTCTGCTTCTAGTCGACTGCTCTATAAAAATAATAATTGAATATTG
GCGGTTTCCGACTAAGGAATTACCATCTTGTTACTCCATTACGTTCT
Genomic location of CT216  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D516 marker 516
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)