Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker CT143

SGN-M518

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATGGGCATTGATCTCAAATTTTTCTTTGTTAGAGCTGGTATGATGGGATGGTTACTTATCAATCTTTCAGTTCTTGCAAAATGTGTTATA
GAGGCTAAATTGAGCCAATCAATGATTCTCTACCAGCTATTTTGTGGGCTCTACATCCTTGACTACTTCTTCTATGAAGAGTTCATGACC
TCCACATGGGATATAATAGCAGAGAGGTTGGGCTACATGCTGGTTTTTGGTGATCTAGTCTTTATACCGTTCACCTTCAGTATTCAGGGT
TGGTGGCTTTTGAGTAACAAAGTGGAGCTAACAACAGCAGCAATAATTGCCAATTGCCTCGTCTTTCTTATTGGGTACTCGGTGTTCAGA
GGAGCCAATAAGCAGAAGCATGTATTTAAAAAGGATCCCAAGGCACCCATATGGGGTAGTCCTCCAAAAGTTATTGGGGGAAAGTTGCTT
GCTTCTGGCTATTGGGGCATTGCACGGCACTGTAAT
Reverse sequence
TTTTTTTTTTGAAAAATAATTCCATAGTTGGCATTCAATACAAGCAGCACATTTAAATCCTGCCATGATAAAGTACATCTAGTGTACAAG
TTGGTTCTGGAAAAACTTTCAAAAGCTAAGCAATCAGTTACAACCTGGATACAGTGTTGATCCTAACTGAAATAGATTAAAAGATTACTT
TCGTAGAGGAGATGAGAAAGCTGCATAGATAGGGCAAAAGCTCGAATTTGATGTAATATTCATTCATGAGTTCGTCCCTTCTCATGCTTG
GGTAGTACGGTACAGTGAGGCTAATTCTGACTCTAATGCACAAGCAACGTGGACAAACGATTGAGCTAGTAAACGTAAGGTAAGATCCTG
TAAGGAACAAGTTTACGGTATTCAGCCCACACATCTTTGTACTTCTCTGCACATCTAGCTTCGTCCCTTCTCTCCCTCCATATGAGTAGA
ATGAGAAGATATATGGGGTAAAAGTATGGAACCACAGAGCTTATACCACAAGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U148443486 (100.0% of RFLP seq)+
SGN-U148443493 (98.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53447)
Chromosome
9
Position
15.10 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51864)
Chromosome
9
Position
47.23 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43634)
Chromosome
9
Position
20.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43496)
Chromosome
9
Position
16.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43034)
Chromosome
9
Position
23.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42300)
Chromosome
9
Position
6.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40738)
Chromosome
9
Position
18.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38976)
Chromosome
9
Position
33.70 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38977)
Chromosome
9
Position
28.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 9359)
Chromosome
9
Position
75.45 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 9354)
Chromosome
9
Position
7.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9353)
Chromosome
9
Position
22.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9361)
Chromosome
9
Position
6.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9360)
Chromosome
9
Position
23.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT143 was used as an overgo probe on plate 14 [well H6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTGGGTACTCGGTGTTCAGAGGA
B sequence
GCTTCTGCTTATTGGCTCCTCTGA
AB sequence
ATTGGGTACTCGGTGTTCAGAGGAGCCAAT
Marker sequence
ATGGGCATTGATCTCAAATTTTTCTTTGTTAGAGCTGGTATGATGGGATG
GTTACTTATCAATCTTTCAGTTCTTGCAAAATGTGTTATAGAGGCTAAAT
TGAGCCAATCAATGATTCTCTACCAGCTATTTTGTGGGCTCTACATCCTT
GACTACTTCTTCTATGAAGAGTTCATGACCTCCACATGGGATATAATAGC
AGAGAGGTTGGGCTACATGCTGGTTTTTGGTGATCTAGTCTTTATACCGT
TCACCTTCAGTATTCAGGGTTGGTGGCTTTTGAGTAACAAAGTGGAGCTA
ACAACAGCAGCAATAATTGCCAATTGCCTCGTCTTTCTTATTGGGTACTC
GGTGTTCAGAGGAGCCAATAAGCAGAAGCATGTATTTAAAAAGGATCCCA
AGGCACCCATATGGGGTAGTCCTCCAAAAGTTATTGGGGGAAAGTTGCTT
GCTTCTGGCTATTGGGGCATTGCACGGCACTGTAAT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT143  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D518 marker 518
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)