SGN Marker CT145

SGN-M52

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT145 image not available
Forward sequence
AACTCCTTTTAGCTGCTGAGCAGGAAGCCCAACGCATCGTCAATGTTGCCAGGACTGCTAAACAAGCTAGATTGAAGCAGGCCAAGGAGG
AAGCTGAGAAGGAGATAGCTGAATTTCGTGCTTACATGGAGGCTGAATTTCAAAGAAAGCTTGAACAGACTAGTGGTGACTCAGGTGCTA
ATGTCAAACGTCTTGAGATTGAAACTAATGAAAAGATCGAACACCTGAAGACTGAAGCGTCAAGAGTCTCTGCTGATGTTGTCCAAATGC
TTCTGAGGCACGTAACCACAGTGAAGAACTAAAATTTTATATGGATGAAGTGTTTCACGCATGTCATTTTGCAGATTTATGCTCCCCCAA
TTCATGGTTCTTGTGCTTGATCAGTCCCATGGATGTTCACCATTTGTATCGTATGTTTGTTATCACTATTTATTGTCTTGCTTTGTTGAA
TAAAATAACTCATTTGAGCTCCTTTCTATGTATCTTTTGTAAACAAAAGATCAGAAACCAAGGTTCAGCGTCTGGGCAGCATGTCAGTTT
CTTATGTATCTAGATTCCAAGGAGTTATGTAGTGAACTTGTCTCTGCAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTGCAGAGACAAGTTCACTACATAACTCCTTGGAATCTAGATACATAAGAAACTGACATGCTGCCCAGACG
CTGAACCTTGGTTTCTGATCTTTTGTTTACAAAAGATACATAGAAAGGAGCTCAAATGAGTTATTTTATTCAACAAAGCAAGACAATAAA
TAGTGATAACAAACATACGATACAAATGGTGAACATCCATGGGACTGATCAAGCACAAGAACCATGAATTGGGGGAGCATAAATCTGCAA
AATGACATGCGTGAAACACTTCATCCATATAAAATTTTAGTTCTTCACTGGGGTTACGTGCCTCAGAAGCATTTGGACAACATCAGCAGA
GACTCTTGACGCTTCAGTCTTCAGGTGTTCGATCTTTTCATTAGTTTCAATCTCAAGACGTTTGACATTAGCACCTGAGTCACCACTAGT
CTGTTCAAGCTTTCTTTGAAATTCAGCCTCCATGTAAGCACGAAATTCAGCTATCTCCTTCTCAGCTTCCTCCTTGGCCTGCTTCAATCT
AGCTTGTTTAGCAGTCCTGGCAACATTGACGATGCGTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1466922.9e-1248 (8.0% of RFLP seq)+
SGN-U1466923e-52191 (31.9% of RFLP seq)+
SGN-U144368587 (98.2% of RFLP seq)+
SGN-U161079472 (78.9% of RFLP seq)+
SGN-U1466926.9e-1048 (8.3% of RFLP seq)-
SGN-U1466926.9e-47158 (27.3% of RFLP seq)-
SGN-U1610795e-171438 (75.8% of RFLP seq)-
SGN-U144368557 (96.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7878)
Chromosome
4
Position
44.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7879)
Chromosome
5
Position
94.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT145 was used as an overgo probe on plate 4 [well H10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P012C02,   P253F16,   P309G21,   P308I19,   P156F04,   P064K15,   P064O06,   P253H16,   P154D16,   P260B01,   P001N08,   P069B20,   P185E03,   P253G16,   P277D16,   P110E09,   P039A14,   P333J17,   P192F23,   P257E03,   P246D10,   P207P24,   P333K16

 Overgo Sequences

A sequence
TGCCAGGACTGCTAAACAAGCTAG
B sequence
CTTGGCCTGCTTCAATCTAGCTTG
AB sequence
TGCCAGGACTGCTAAACAAGCTAGATTGAA
Marker sequence
AACTCCTTTTAGCTGCTGAGCAGGAAGCCCAACGCATCGTCAATGTTGCC
AGGACTGCTAAACAAGCTAGATTGAAGCAGGCCAAGGAGGAAGCTGAGAA
GGAGATAGCTGAATTTCGTGCTTACATGGAGGCTGAATTTCAAAGAAAGC
TTGAACAGACTAGTGGTGACTCAGGTGCTAATGTCAAACGTCTTGAGATT
GAAACTAATGAAAAGATCGAACACCTGAAGACTGAAGCGTCAAGAGTCTC
TGCTGATGTTGTCCAAATGCTTCTGAGGCACGTAACCACAGTGAAGAACT
AAAATTTTATATGGATGAAGTGTTTCACGCATGTCATTTTGCAGATTTAT
GCTCCCCCAATTCATGGTTCTTGTGCTTGATCAGTCCCATGGATGTTCAC
CATTTGTATCGTATGTTTGTTATCACTATTTATTGTCTTGCTTTGTTGAA
TAAAATAACTCATTTGAGCTCCTTTCTATGTATCTTTTGTAAACAAAAGA
TCAGAAACCAAGGTTCAGCGTCTGGGCAGCATGTCAGTTTCTTATGTATC
TAGATTCCAAGGAGTTATGTAGTGAACTTGTCTCTGCAAAAAAAAAAA
Genomic location of CT145  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D52 marker 52
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)