Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG240

SGN-M520

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2220
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATAGGATAGGCTTCAACAGATAAAATTGAGAGAGAGACAGAGAATACCCAAAAAAAACCTCTCACTCTCTAACAATGGCAACCCTTTCCC
TGTGTTCTACATCTTCCCCCTCAACAGCACTTTCCAAGAACCAAACTTTTCTTAACACCCTTTCTGTTCCCAAAGCAAATTCCAATGTTA
CTTTTCTATCTCACTCATTTTCCTCTCTCAATCTCCGTTTCTCCAAGCCCAATTCTTTATCCTCTTTTGTACCCAAATACTCAGAATCTG
AAGCTCCAGTAGCTGAAGTTGAAGCTGACCAAGAAGAGCCTGTTGTGGAAGCCACTAGCTTGGAACCAAAACGGGAAGAAATCTTTGCTG
TTGTTATGGTGACGACTCACTTCCATTCATGTTTAAATTTGTGTAGACATATCTGTTTGTTTTCAATTTCGAAATCAATGTGAGGGTACA
ATTTAGATTTTTATTGAAAAAATTATGAGGTCCCAAATGAAAATTTGAAAATTCAGCGGAA
Reverse sequence
CTCACTATAGGGAGACAGCTTGCATGCCAGAAGAAGCACAAGTATAGATGCTTCAACAATGATCCTCATTGTGGAAATTTTGAAATAAGA
GTATTGCCAATATGGCAAGAAAACCTTGACATACACATATAACCCTTATATCAAGTGTTAGCTTCCGTGGAAAATAACTGGTGAAGACAA
TGTATTAAAGATAATAGAAATAGGACAAGCAAATGTCACTATTGGTTGAAATTGATGCCTTTTGACATAATTGAGAAATTGCTGCAAGCA
AGTTCTTTTTGATTGGACACCACAATGTTGATATGAGATAGCGAGACAAGGAAAAAGAAAAACAACTCACGTAACTAAAGCCAAAGCCAC
AGAGAGGTAACCAGATTTTGGGAAATCAATTGTAAATTAAGACCAAAAATGCTCACTTTGTCATTGACATTTGCACCTTTAAGCCTCTGG
GTGTAGATATACCGCCCAGGAAAAACAATATATTGCCGAGATCCAACCTATGAAAGCGAAAGAGCAAAAATGAACAAACAGCTTAACGTA
T
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450101e-177313 (61.3% of RFLP seq)+
SGN-U161340449 (87.9% of RFLP seq)+
SGN-U1450109.3e-4082 (15.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53231)
Chromosome
6
Position
29.92 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42423)
Chromosome
6
Position
67.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9364)
Chromosome
6
Position
74.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9363)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9365)
Chromosome
6
Position
19.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG240 was used as an overgo probe on plate 4 [well E12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P164M01,   P156F11,   P313F23,   P070A06,   P201C24,   P039A07,   P084L02,   P306L01,   P207D01,   P032D19,   P152P16,   P241P23,   P178E18,   P138P11,   P185F13

 Overgo Sequences

A sequence
AGCTCCAGTAGCTGAAGTTGAAGC
B sequence
AGGCTCTTCTTGGTCAGCTTCAAC
AB sequence
AGCTCCAGTAGCTGAAGTTGAAGCTGACCA
Marker sequence
TCAACAGCACTTTCCAAGAACCAAACTTTTCTTAACACCCTTTCTGTTCC
CAAAGCAAATTCCAATGTTACTTTTCTATCTCACTCATTTTCCTCTCTCA
ATCTCCGTTTCTCCAAGCCCAATTCTTTATCCTCTTTTGTACCCAAATAC
TCAGAATCTGAAGCTCCAGTAGCTGAAGTTGAAGCTGACCAAGAAGAGCC
TGTTGTGGAAGCCACTAGCTTGGAACCAAAACGGGAAGAAATCTTTGCTG
TTGTTATGGTGACGACTCACTTCCATTCATGTTTAAATTTGTGTAGACAT
ATCTGTTTGTTTTCAATTTCGAAATCAATGTGAGGGTACAATTTAGATTT
TTATTGAAAAAATTATGAGGTCCCAAATGAAAATTTGAAAATTCAGCGGA
A
Genomic location of TG240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D520 marker 520
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)