SGN Marker CT87

SGN-M521

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT87 image not available
Forward sequence
AAAGGACTTGGATATGCTTGTGGAGACAATAACATCATGGATGTACTCTAACACTGGCCCAAAACTTTTACAGTGATATATGCTAAAAAA
AATATATGTATATGAACCCTACTGAATGGTTCTGTAATTTGTAATGATTGTATATACTTGATTGACATTTAGTACTCATGTATAATAATG
TGACTAACTTTTTGAAAAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTTTCAAAAAGTTAGTCACATTATTATACATGAGTACTAAATGTCAATCAAGTATATACAATCATTACAAATTACAGA
ACCATTCAGTAGGGTTCATATACATATATTTTTTTTAGCATATATCACTGTAAAAGTTTTGGGCCAGTGTTAAAGTACATCCATGATGTT
ATTGTCTCCACAAGCATATCCAAGTCCTTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1540681.1e-92194 (92.4% of RFLP seq)+
SGN-U1540682.6e-90194 (92.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39077)
Chromosome
1
Position
21.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9366)
Chromosome
1
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT87 was used as an overgo probe on plate 3 [well C8]

Plausible BAC Matches:   P069E17

 Non-Plausible BAC matches

P265P22,   P125N10,   P026A12,   P215C08,   P319K21,   P006P01,   P124P11,   P240F10

 Overgo Sequences

A sequence
GTGGAGACAATAACATCATGGATG
B sequence
GGCCAGTGTTAGAGTACATCCATG
AB sequence
GTGGAGACAATAACATCATGGATGTACTCT
Marker sequence
AAAGGACTTGGATATGCTTGTGGAGACAATAACATCATGGATGTACTCTA
ACACTGGCCCAAAACTTTTACAGTGATATATGCTAAAAAAAATATATGTA
TATGAACCCTACTGAATGGTTCTGTAATTTGTAATGATTGTATATACTTG
ATTGACATTTAGTACTCATGTATAATAATGTGACTAACTTTTTGAAAAAA
AAAAAAAAAA
Genomic location of CT87  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D521 marker 521
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)