SGN Marker CT217

SGN-M522

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT217 image not available
Forward sequence
GATCCGGCACAGGATGAATTGGATCTGAAAGAAGCGTTTGATGTTTTTGACTATAACGGGGATGGATTTATATCGGCGAAGGAATTGCAG
GTGGTGTTAGAGAAATTGGGATTACCGGAAGGAAGTGAAATTGATAGACCGGAGATGATGATTTCTTCATTTCATCAGGATCATGATGGT
CGCGTTGATTTCTTCAAGTTCAAAGATATGATGCGTACTGTTATTGTTCCTTCATGATTTTTACTTTCCAGATTCTCGGCGCCGGAATGT
GACATCACTTTACGGCCGGTTATTTTTACTTGCTTCTTTTTCTG
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAGCTGATTTAACTTTAGGGTAATATTGATGATGCATAATTTTTCACATTATACGATAAGT
ATGTTTGATACAAAGATGGCACAAAACAGCTGAACCAAATACAGAAAAAGAAGCAAGTAAAAATAACCCGCCGTAAAGTGATGTCACATT
CCGGCGCCGAGAATCTCGAAAGTAAAAATCCTGAAGGAACAATAACAGTACGCATCATATCTTTGAACTCGAAGAAATCAACGCGACCAT
CATGATCCTGATCAACTGACGAAATCATCATCTCCACTCTATCAATTTCACTTCCTTCCGGTAATCCCAATTTCTCTAACACCACCTGCA
ATTCCTTCGCCGATATAAATCCATCCCCGTTCTCGTCAAAAACATCAAACGCTTCTTTCAGATCCAATTCATCCTGTGCCGGAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1476341e-154314 (100.0% of RFLP seq)+
SGN-U147634411 (92.6% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42328)
Chromosome
10
Position
82.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39020)
Chromosome
10
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9370)
Chromosome
10
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9369)
Chromosome
10
Position
36.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT217 was used as an overgo probe on plate 14 [well H2]

Plausible BAC Matches:   P189B10,   P250H11,   P204A16,   P263B10,   P204I05,   P158N21

 Overgo Sequences

A sequence
TGCAGGTGGTGTTAGAGAAATTGG
B sequence
CTTCCTTCCGGTAATCCCAATTTC
AB sequence
TGCAGGTGGTGTTAGAGAAATTGGGATTAC
Marker sequence
GATCCGGCACAGGATGAATTGGATCTGAAAGAAGCGTTTGATGTTTTTGA
CTATAACGGGGATGGATTTATATCGGCGAAGGAATTGCAGGTGGTGTTAG
AGAAATTGGGATTACCGGAAGGAAGTGAAATTGATAGACCGGAGATGATG
ATTTCTTCATTTCATCAGGATCATGATGGTCGCGTTGATTTCTTCAAGTT
CAAAGATATGATGCGTACTGTTATTGTTCCTTCATGATTTTTACTTTCCA
GATTCTCGGCGCCGGAATGTGACATCACTTTACGGCCGGTTATTTTTACT
TGCTTCTTTTTCTG
Genomic location of CT217  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D522 marker 522
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)