SGN Marker TG241

SGN-M524

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAAATGGAAGGTAGTGTTTGGGAAATATATAAAAAGATGTGGTTCTGCAATTATGGAGGAAAATTAATGGCACAAGATATCCTTGATATT
AAAAATCTAGCTTAGTGTATTAATTGTTGACACAAGAAAAGAAAGACCTGTTTGAGAGTGCATTTACGTTGTTGATAGTAGTGGAATGCA
AGTTATGTTCAAGATTCCTTTTAGTGCCCAATAGAAACAGCAGGCATATCTAACTTATTGGATCAAAAAAATGCAGGCATAATCAACTAC
TTTGTGATGAGAAACAGAAGATTTGTCTTAGATCAGTTAATACAAAATAAATAGATTTTACTTTGCAGTATGCAATTTACTTTAACTTGT
TTACTGATGTGGATATTCCAATTTTGTCATTTTAACAACTTCCGTCAGATTCATGTGGGTGTTATTTTCACTTCTCATTTCACGCCCTGC
TGAAAAGCTAATTCATATTTAATACCTAGTTTGTTTGTATTTTTCTTACAGTG
Reverse sequence
AGTTGAAAGCGAATTGCCTGGGTAGTACTCTTTAAAGAAATAAAAATCAGAACATTAAAGGTAAAATGATGTCTTTAAAATCCAGACACT
TCAATGAAAATATATGAGATGCGTACCAGTGGAAGAATCAGCAAGAATTTGGAGAGCATTAATAATGTCAGAGAATTAACAAATGGCTGA
GACCAACTGTCATAAGATTTTGCAGATATTCGAGCATTAAGCAATGCAAGTGCAATCTGAGTAGCATAATGAATGAGCATAAGCAGAGAA
ACAAACCTAATACAGTGACATACAAGTGAATACAATGAGAATTAAAACGAAAAAAGAACAAGATGGATGCTAAACCACAAAATAGGGTGT
CTGGACGATAACAGTGGTTACACGAAATAGTGTTCTCATGAAAAATTAAGTGAAATTCGCATAAAATCCTTAGTAGAAAATATAAGCCTT
TAGTCAAGATACTAAAAGTTACAATAACAGGCATCTCTCAGTTCATAAGCAATCAGAAAAGATGTCTACCTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Pepper Capsicum   
Map version
65 (location: 42835)
Chromosome
10
Position
85.40 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Eggplant-COSII   
Map version
63 (location: 42424)
Chromosome
10
Position
103.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40847)
Chromosome
10
Position
71.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36576
Forward primer (5'-3')
TGGAGGAAAATTAATGGCACA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGATCCAATAAGTTAGATATGCAT
Digested band sizes (using SphI)
Solanum pennellii TA56
310
Solanum lycopersicum TA209
280
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39956)
Chromosome
10
Position
71.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9380)
Chromosome
10
Position
65.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9382)
Chromosome
10
Position
86.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9381)
Chromosome
10
Position
67.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG241 was used as an overgo probe on plate 5 [well D6]

Plausible BAC Matches:   P152O13,   P152K07,   P049K02

 Overgo Sequences

A sequence
GACCTGTTTGAGAGTGCATTTACG
B sequence
CCACTACTATCAACAACGTAAATG
AB sequence
GACCTGTTTGAGAGTGCATTTACGTTGTTG
Marker sequence
AAAATGGAAGGTAGTGTTTGGGAAATATATAAAAAGATGTGGTTCTGCAA
TTATGGAGGAAAATTAATGGCACAAGATATCCTTGATATTAAAAATCTAG
CTTAGTGTATTAATTGTTGACACAAGAAAAGAAAGACCTGTTTGAGAGTG
CATTTACGTTGTTGATAGTAGTGGAATGCAAGTTATGTTCAAGATTCCTT
TTAGTGCCCAATAGAAACAGCAGGCATATCTAACTTATTGGATCAAAAAA
ATGCAGGCATAATCAACTACTTTGTGATGAGAAACAGAAGATTTGTCTTA
GATCAGTTAATACAAAATAAATAGATTTTACTTTGCAGTATGCAATTTAC
TTTAACTTGTTTACTGATGTGGATATTCCAATTTTGTCATTTTAACAACT
TCCGTCAGATTCATGTGGGTGTTATTTTCACTTCTCATTTCACGCCCTGC
TGAAAAGCTAATTCATATTTAATACCTAGTTTGTTTGTATTTTTCTTACA
GTG
Genomic location of TG241  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D524 marker 524
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)