SGN Marker CT89

SGN-M526

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT89 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTAGGTTTCGATCTCTTATATTATATAGCATTAGATCTTTTCTCCCTTGTGTGTAAAAATGTTCAAGCAGAGAG
CAGTTTCCATGGTTTTAGGTTCCATTGTAGTATCAAAGTTAATGTAAGATAGGGTGAAGTGTGATCCATATCCAAAGTTAAATTTATTTT
ATATGGTATCAAATAGTAAACATTATTTGGATTCAATGCTTTTTAGTTTAGTGTTTGGTTGTCACNAAAAAAAAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGGGCCCCCCACCCCCAAAAAA
AAAAGCTTTGAACCCCAAAAAGGGTTCCCTTTTGAACCCCCAAAAAAAAAATTTACCTTTGGGAAGGGGACCCCCCCCCCCCCCTTTTAA
ATTAACTTTGAAACCCCAAGGGAACCCAAAACCCGGGAAACCCCCCCCCCCTTGAACTTTTTTTCCCCCCGGGGGAAAAAAAACCTTGGG
TTTTTTATTTAAAAAACCCCACCCCCAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9387)
Chromosome
5
Position
2.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT89 was used as an overgo probe on plate 5 [well A12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCCTTGTGTGTAAAAATGTTCAAG
B sequence
TGGAAACTGCTCTCTGCTTGAACA
AB sequence
CCCTTGTGTGTAAAAATGTTCAAGCAGAGA
Marker sequence
CTTTTTTTTTTTTTTTTTAGGTTTCGATCTCTTATATTATATAGCATTAG
ATCTTTTCTCCCTTGTGTGTAAAAATGTTCAAGCAGAGAGCAGTTTCCAT
GGTTTTAGGTTCCATTGTAGTATCAAAGTTAATGTAAGATAGGGTGAAGT
GTGATCCATATCCAAAGTTAAATTTATTTTATATGGTATCAAATAGTAAA
CATTATTTGGATTCAATGCTTTTTAGTTTAGTGTTTGGTTGTCACNAAAA
AAAAAAAAAAAAAAAA
Genomic location of CT89  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D526 marker 526
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)