SGN Marker TG170

SGN-M527

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1720
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCATGTCCTAAATTAATTCGTGAAATGGATAAAGACTATTCATTTAACCGACCAATTTTGGATAACTCCAGCTCCCCCGACTTGAAAACA
TTTACCCAAAATAAAGTTCAAGTTAACAACTAGCTCAGCTCATAATTCAGTCTCCCATAACCAGCATTGCCGAAAACATGAAAACTAGCA
TCCCTCTCCAGCTCTACTTCAACGCAAAACAACTTGAAATATAATAATATTTGTTGTTCCTTACCATCTCCAGGGTCAGTTTCATCTGAA
AGCTGAACAGCAAAAATCAACAAAATCCCCACCAAGATCTCCAAACTCAAGCACCCTAACACAGATCTCTTCCCACCCATTGATCCAAAC
TGTAACCCTTTTCTTCAATCTACTCTTTCTTTGGAAACACACTCTGCATAACCAATACATAAACCTCCAATCTGAAATAGCCCAAAAAAA
TCAGTACTTCAATCAAACCCAAAATTCATCATAACACAACCAAAAAGAAGCAAATCAATGACACCCAAACTG
Reverse sequence
CTCCTATAGGGAGACAGCCTGCATGCCTGCAGGCACAAAAAATAATATGGGGCTACAGCCTATAACAATTTCCCATTTTGTTTTTCTGTG
TCCAGTTTCTTAATATGGCGGCTATAATTTAATAACTCATCATTCAGCCTAAAGTATATATATAACATGTAAACATGAAATTTAATTTGA
TATCAATTAATATTATGAATTTTAATTTAATTTTATACATAAAACAGTATCAAATGGATACATTCATTTTATATAATAGTGTTATGTTCA
ACATAATATTCTATGTATATATAATACATATATTTATTTGATTAATTTAACATAATTTAATTATCTATTTATATAAACTCTTTATGTATT
ATGCTTAAAAAATAGGGGAAATAAGCCAATTTTAGTTTTAATATTACTAGCACTTCATTTTTTTAAAAAAACAAGCTCATATTATCACAC
GCGCCATTTAACGACACAACGGTTTAATTGACCGTTAATATATAATAAACCAATCATTTCACTCCATCTGTCAGTATTAATAAGCTAAGA
AAATCACGCGCAGCGTTGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53874)
Chromosome
7
Position
31.50 cM
Confidence
uncalculated
Protocol
RFLP

Eugenol_content_eug7_1
Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39922)
Chromosome
7
Position
43.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9388)
Chromosome
7
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG170 was used as an overgo probe on plate 1 [well B6]

Plausible BAC Matches:   P048I07,   P003E23

 Overgo Sequences

A sequence
ATCCCCACCAAGATCTCCAAACTC
B sequence
CTGTGTTAGGGTGCTTGAGTTTGG
AB sequence
ATCCCCACCAAGATCTCCAAACTCAAGCAC
Marker sequence
TCATGTCCTAAATTAATTCGTGAAATGGATAAAGACTATTCATTTAACCG
ACCAATTTTGGATAACTCCAGCTCCCCCGACTTGAAAACATTTACCCAAA
ATAAAGTTCAAGTTAACAACTAGCTCAGCTCATAATTCAGTCTCCCATAA
CCAGCATTGCCGAAAACATGAAAACTAGCATCCCTCTCCAGCTCTACTTC
AACGCAAAACAACTTGAAATATAATAATATTTGTTGTTCCTTACCATCTC
CAGGGTCAGTTTCATCTGAAAGCTGAACAGCAAAAATCAACAAAATCCCC
ACCAAGATCTCCAAACTCAAGCACCCTAACACAGATCTCTTCCCACCCAT
TGATCCAAACTGTAACCCTTTTCTTCAATCTACTCTTTCTTTGGAAACAC
ACTCTGCATAACCAATACATAAACCTCCAATCTGAAATAGCCCAAAAAAA
TCAGTACTTCAATCAAACCCAAAATTCATCATAACACAACCAAAAAGAAG
CAAATCAATGACACCCAAACTG
Genomic location of TG170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D527 marker 527
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)