SGN Marker CT149

SGN-M529

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT149 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTGAGCAAAGAGAATAATACTTGTTCTGATTATAGGACTAACCATTAATCCAAAATAAAAAGCTTTACAAAAGC
TATTCAATAATTCCATCATTAGAGTCTTTTTTTTCACAAACACAATATATTTAACATAAAACTAAACTTATTCATCGATCTCTTTCCCCT
TAAATACAATAAACCCCTCCATCCATACTTAATCCCCAGACCTAAAATATAAAATAAGAAGAAGAAATTATTCGCATTTTTTTCTCAAAT
TTCAGACCTTTTGCTCATCACTATATATATATATATATATTATAACAACGATTATAAGTTTTTCTGACGAAGAGAAAAAATTATGGGTTT
TCCGGTGGGATATACGGATTTATTCCTACCCAAATTGTTAGTACACTTACTAACGGTTCTCGGATTCGTCAGAAAGTTCATTTGCACGAT
TTTCACTGTTTTTGGTTTAGGAGATTTTCTCGAACCG
Reverse sequence
GGAATTCCTTTTTTTTTTTTTTTTTTTAAAAATTAAAACTATTTATCTTCATTCCATATTCTCAAAATTGTAGACACTATACAATAACTT
TTTCCTCCATAATTATTTTTCCCCCTCTTTTTTTTATCTTATAGTATATATACATTTTTAAACTATAAAAAAAAATTGCTACAAACCGGC
GGCGACCGGAGAATACTCGCCGTAAAAATCAGAAATGCCGGAAGCCAACCATAATCTCTCATTAAAGCTCTCTTGCATATCGTCCGGAAT
AAATGGCGTCCGGCAAAGTGGACACGTTTTCTGATCATGATCCATCCAACGATCCAAACAACTCCGGTGAAAAATATGCCGGCAATTCGT
CAACCGTCGGATCTCATCCTCTCCGTCAAACTCATACAAACAAACTGCACAACTCTCCGGCGGGTCAACCAGCTCAGAGAACTTCACCAC
CGGAAGTAGCTCCCGGATCAACGCCGCCGACACTGAATGAAGCTCCGAGTGTGAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1434461.1e-63143 (29.4% of RFLP seq)+
SGN-U1434494.8e-69156 (32.0% of RFLP seq)+
SGN-U1594851e-91177 (36.3% of RFLP seq)+
SGN-U1434475e-112252 (51.7% of RFLP seq)+
SGN-U159485380 (75.2% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43635)
Chromosome
1
Position
49.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43497)
Chromosome
1
Position
34.20 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43035)
Chromosome
1
Position
53.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40739)
Chromosome
1
Position
66.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9397)
Chromosome
8
Position
69.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9398)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9399)
Chromosome
1
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT149 was used as an overgo probe on plate 15 [well D2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATGGGTTTTCCGGTGGGATATAC
B sequence
GGGTAGGAATAAATCCGTATATCC
AB sequence
TATGGGTTTTCCGGTGGGATATACGGATTT
Marker sequence
CTTTTTTTTTTTTTTTTTGAGCAAAGAGAATAATACTTGTTCTGATTATA
GGACTAACCATTAATCCAAAATAAAAAGCTTTACAAAAGCTATTCAATAA
TTCCATCATTAGAGTCTTTTTTTTCACAAACACAATATATTTAACATAAA
ACTAAACTTATTCATCGATCTCTTTCCCCTTAAATACAATAAACCCCTCC
ATCCATACTTAATCCCCAGACCTAAAATATAAAATAAGAAGAAGAAATTA
TTCGCATTTTTTTCTCAAATTTCAGACCTTTTGCTCATCACTATATATAT
ATATATATATTATAACAACGATTATAAGTTTTTCTGACGAAGAGAAAAAA
TTATGGGTTTTCCGGTGGGATATACGGATTTATTCCTACCCAAATTGTTA
GTACACTTACTAACGGTTCTCGGATTCGTCAGAAAGTTCATTTGCACGAT
TTTCACTGTTTTTGGTTTAGGAGATTTTCTCGAACCG
Genomic location of CT149  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D529 marker 529
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)