SGN Marker TG356

SGN-M53

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG356 image not available
Forward sequence
TTTCAGTGGAGGGCTTTTGATGTTCTGGGAATTATTTTTGAGGGATGTCTCATGTAGTTTGTTGTACTATCGTATATTTATTTCATCCCG
TGTTGGAGTAGTACAAATGTTTAATTCTATTACTAGATAGTTCAAGTTTCTAGAGTATCAACCATTTATTAGTAGTTGCAAGATCTACTT
GAAGCTAGAGGTGGATGCTTGCATTATTAGCTGGAGTAATGGATTTGGTGATTATGATTTATCTCTTCTTTTAGCAGGACATATGTAATT
AACTAAATATCATGTGAATTGACTTCAGGGTGCCATATTTATTACCTGGCACTACAGCACAACCGCATAAGTCATATCCGGCAGTTTTTC
ATCTTTTAGCTTCAAGTTGCTAGATTTTATTTGTGTATAATATTGTTTCGTTCTTCTTCCTTGATGCTACTGGACATTAACTACGTAGAA
TTACCGCAAAATTAAGACACCAAATGTGCTTAATA
Reverse sequence
CTCCATGACAGTCGGGTATGCATCCTTGAGGTCGATAACAGCAATACCCTCAGGGAATTTTCTTATCAAGATAAGTAGTTGCTCTTTATT
TTTCAGAGCATGTTTCGACTGTTGACAAATAATAAGTGAATTTATGTTACTAAAGAGTAAAGACACACAGATTCAGAGTTGATTACAAAT
GACTTAAAGACAGAGGAGTACAATTAAGAAGACCTTAATTTACCTTATAAGAAAAGCGATTGCCATCATAATATACTTTGACGTTTTTCC
TCAAACTGTCAAACACAGGTTTATTGCCAATTAAATCAACATAACATGCTTCATTGATCTGTTCTGGTGTGAAAGCTTGCCTTGTCTGCA
TGTATGGAAATTAATTAGTTATCAATATTACAAGTACTACGACTACAGAATATGTCACAGTTCCCTATAAGATAACAGGACAAGACACTA
TTAATCAAGGTGGAGAATCCAGCTAAAATGGAGAGTTACACAAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1446401.7e-56110 (22.2% of RFLP seq)-
SGN-U1446408e-71134 (27.0% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53889)
Chromosome
6
Position
35.10 cM
Confidence
uncalculated
Protocol
RFLP

3_Methylthio_propanal_content_mta6_1 2_Isobutylthiazole_content_ibt6_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53543)
Chromosome
6
Position
40.35 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43860)
Chromosome
6
Position
51.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43603)
Chromosome
6
Position
37.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43322)
Chromosome
6
Position
50.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40864)
Chromosome
6
Position
48.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7880)
Chromosome
6
Position
48.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXHIR 1997

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7881)
Chromosome
6
Position
44.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Genomic location of TG356  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D53 marker 53
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)