SGN Marker TG248

SGN-M530

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
580
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAAAAAACAGATGTAATGCCTCATACCAAGTATTACATGGTTAGCATCTGTTGCACAAACCACCATGAACATGGGGCTAAATCCTCTCTT
TGTAGCTTGTAGTCTTGAACTTGGACCTGGAAGATAAATTTCTAAAAGTTATGGTAGCGATCTGTACAATCAACGTCGATCAGGAACCTG
AATTTGCCATATGGAACTTAGAAATGGAGTAGAAAGGAAAATGCATTTGGTTTTAGAGGCTTGAATTGAGAAGGCCAAACAGTTTAATAC
TGTGGGGAGGCGTGAATGAGATGGACGAATTTAGACCCCCTTCTCCTTGTTTCCTATCCTTGATTGCTTACTGGTTGCTCAAGAGCCTTA
ACTGGAGTTTATTTTCTCTCAGAAAGTTACCATTATGCAAATGCATGATCTTCAAAATTACCAGTTTGGTAGCAAATTCAGTTGGATTTC
TGTTATTTTATTGAGAAACATGCAGTAAACGGTGAATATTGTGTGT
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGATGATCATACAGCTGCAAAATAGAGAAGAGATATGAGTCAAACTATTCTAACATATCCTGTGAGTGA
TGGTGACACAGACTATCTCAGATCAATAAATAGTTTCACTACTTTCGAGCTTGAAAACAGTATCAGACTCTCAGAAAAAATTATTCAAGG
ACACACAATATTCACCGTTTACTGCATGTTTCTCAATAAAATAACAGAAATCCAACTGAATTTGCTACCAAACTGGTAATTTTGAAGATC
ATGCATTTGCATAATGGTAACTTTCTGAGAGAAAATAAACTCCAGTTAAGGCTCTTGAGCAACCAGTAAGCAATCAAGGATAGGAAACAA
GGAGAAGGGGGTCTAAATTCGTCCATCTCATTCACGCCTCCCCACAGTATTAAACTGTTTGGCCTTCTCAATTCAAGCCTCTAAAACCAA
ATGCATTTTCCTTTCTACTCCATTTCTAAGTTCCATATGGCAAATTCAGGTTCCTGATCGACGTTGATTGTACAGATCGCTACCATAAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42425)
Chromosome
9
Position
74.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9401)
Chromosome
9
Position
82.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9400)
Chromosome
9
Position
72.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG248 was used as an overgo probe on plate 14 [well H11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P136D06,   P090C08,   P136C06,   P037E22,   P266K22,   P267K22,   P074G09

 Overgo Sequences

A sequence
TGGTAGCGATCTGTACAATCAACG
B sequence
TCAGGTTCCTGATCGACGTTGATT
AB sequence
TGGTAGCGATCTGTACAATCAACGTCGATC
Marker sequence
TAAAAAACAGATGTAATGCCTCATACCAAGTATTACATGGTTAGCATCTG
TTGCACAAACCACCATGAACATGGGGCTAAATCCTCTCTTTGTAGCTTGT
AGTCTTGAACTTGGACCTGGAAGATAAATTTCTAAAAGTTATGGTAGCGA
TCTGTACAATCAACGTCGATCAGGAACCTGAATTTGCCATATGGAACTTA
GAAATGGAGTAGAAAGGAAAATGCATTTGGTTTTAGAGGCTTGAATTGAG
AAGGCCAAACAGTTTAATACTGTGGGGAGGCGTGAATGAGATGGACGAAT
TTAGACCCCCTTCTCCTTGTTTCCTATCCTTGATTGCTTACTGGTTGCTC
AAGAGCCTTAACTGGAGTTTATTTTCTCTCAGAAAGTTACCATTATGCAA
ATGCATGATCTTCAAAATTACCAGTTTGGTAGCAAATTCAGTTGGATTTC
TGTTATTTTATTGAGAAACATGCAGTAAACGGTGAATATTGTGTGT
Genomic location of TG248  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D530 marker 530
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)