SGN Marker TG177

SGN-M532

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
450
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG177 image not available
Forward sequence
GGGAGACAAGCTTGCATGCCTGCAGTCAAACTGATCACTTGAACATTTTAAGCCTAGAATCCATTAAATTAAATAATTTTGCTACGTTTC
CTATATAAGAAGCCTCCTCTTCATTACACCAGCCAAATAAAAGATCAACAAAGAAGGGGGTAATACGAATAAAGAGGAGGTATGAAGTTA
CATCCATCTCAAAAGAATTCTACCAAAACTCCTAATGCTTACGTGAATCGTAACCCTTGATACAAGTATATCAGCTA
Reverse sequence
TATAGGGAGACAAGCTTGCATGCCTGCAGTCAAACTGATCACTTGAACATTTTAAGCCTAGAATCCATTAAATTAAATAATTTTGCTACG
TTTCCTATATAAGAAGCCTCCTCTTCATTACACCAGCCAAATAAAAGATCAACAAAGAAGGGGGTAATACGAATAAAGAGGAGGTATGAA
GTTACATCCATCTCAAAAGAATTCTACCAAAACTCCTAATGCTTACGTGAATCGTAACCCTTGATACAAGTATATCAGCTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50352)
Chromosome
6
Position
35.52 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48287)
Chromosome
6
Position
48.99 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39925)
Chromosome
6
Position
43.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9405)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG177 was used as an overgo probe on plate 4 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAAGCTTGCATGCCTGCAGTCAA
B sequence
TGTTCAAGTGATCAGTTTGACTGC
AB sequence
ACAAGCTTGCATGCCTGCAGTCAAACTGAT
Marker sequence
GGGAGACAAGCTTGCATGCCTGCAGTCAAACTGATCACTTGAACATTTTA
AGCCTAGAATCCATTAAATTAAATAATTTTGCTACGTTTCCTATATAAGA
AGCCTCCTCTTCATTACACCAGCCAAATAAAAGATCAACAAAGAAGGGGG
TAATACGAATAAAGAGGAGGTATGAAGTTACATCCATCTCAAAAGAATTC
TACCAAAACTCCTAATGCTTACGTGAATCGTAACCCTTGATACAAGTATA
TCAGCTA
Genomic location of TG177  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D532 marker 532
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)