SGN Marker TG91

SGN-M534

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG91 image not available
Forward sequence
TAAAGAGAAACGCTAATTAAAGTATCATATTTAACTGAAAGATCATCACCTACACGCTATAAAAATATTTATGAACAAAGCATCTATGAT
CTATGCGATGACTAATTACGAGAAAAAATATATATATCTATCTTTACAAATCGCTGCTAATTCCATGATTTATCAATATGAGAACAATAT
CACTACTTCACCGGGTGCTAAACCCTTGTGACTTTGAGAAA
Reverse sequence
GGGGGGGGGGTTTTCAAATCATTTTTAATTAATTTTTTTTAAAAAAAGAAGCAAAAAATAAAAAAAAAGATTAAACTTAAGTCTCAGCAG
CGACATATTAAAAAAATTATTTTGAAAATTGCTTCTTTGGTAGCAATTTTGTTTAATTTTTTTTTAAAAAAAAATAATCAAATTTAACAA
ATCGCTGCGATAGCAGTGATTTTGCTTTTTTCGGACAAAATCGCTACTTCATCAGCGATTTTACCATTTTGGTTTTTAAAAAAATTTATA
CACCGTTTTGAAATTTTTATCTATATTTTTCACTCTTTAGACACCGGACCCGAGAATGTGAGTACATTTTTTTAGGTCTGCGAGATTAAA
GAAAATAAAAATAAAAAACCAGCTTTTTTTCTAGGCTAATTTGGGGGAAAGAAAACCTTGATTGGAATTTCCATTTATCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40825)
Chromosome
2
Position
90.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9408)
Chromosome
2
Position
102.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9409)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG91 was used as an overgo probe on plate 6 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATCACTACTTCACCGGGTGCTAAA
B sequence
CTCAAAGTCACAAGGGTTTAGCAC
AB sequence
ATCACTACTTCACCGGGTGCTAAACCCTTG
Marker sequence
TAAAGAGAAACGCTAATTAAAGTATCATATTTAACTGAAAGATCATCACC
TACACGCTATAAAAATATTTATGAACAAAGCATCTATGATCTATGCGATG
ACTAATTACGAGAAAAAATATATATATCTATCTTTACAAATCGCTGCTAA
TTCCATGATTTATCAATATGAGAACAATATCACTACTTCACCGGGTGCTA
AACCCTTGTGACTTTGAGAAA
Genomic location of TG91  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D534 marker 534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)