SGN Marker TG92

SGN-M535

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG92 image not available
Forward sequence
GGGGGGGGGGTATAGCTCCCCTTCCACAAAACTATGCTATAATAGCAGAAAGAGAACTAAAATTTGCAATGCCCTGAGTTGAAAGATTAT
ATGATTAACGAGGTCTCCAGATCTTTTTAAAGCTTAAAATTGTTAATTTTACATGACCGCAACTACTTAAATTAGAGGTGAAGTGTAACT
TGGTTTTACTTATACCAGATATACATCAATGATCCAACAAAAGAGTGCATTGATACACCAGTTACTCAGTAATATATCCGCTGATCTGCA
TACATCTATCAGCAGCACCAAAATCCCTATCGAAATCAGAAGCTCTCGCTCTTGAAAATGAGCATATAGATTTTGTTATGGAATGAGAAG
TACCTACATCCTAAGTTGCTTGGACTCGGGTGCGGATGTCCGATACAATTGCAGATCTAGAGGTTGGATTTTTCATGATCTAATTCTTAA
GATTTGGGGATATGAATCCATTTACGGATATGGGTGTGGGTATTTGCCTAAAAATAATTAAAATATCTAA
Reverse sequence
GGGGGGGGGGTATAGCCACCCTTCCCCAAAACTATGCTATAATAGCAGAAAGAGAACTAAAATTTGCAATGCCCTGAGTTGAAAGATTAT
ATGATTAACGAGGTCTCCAGATCTTTTTAAAGCTTAAAATTGTTAATTTTACATGACCGCAACTACTTAAATTAGAGGTGAAGTGTAACT
TGGTTTTACTTATACCAGATATACATCAATGATCCAACAAAAGAGTGCATTGATACACCAGTTACTCAGTAATATATCCGCTGATCTGCA
TACATCTATCAGCAGCACCAAAATCCCTATCGAAATCAGAAGCTCTCGCTCTTGAAAATGAGCATATAGATTTTGTTATGGAATGAGAAG
TACCTACATCCTAAGTTGCTTGGACTCGGGTGCGGATGTCCGATACAATTGCAGATCTAGAGGTTGGATTTTTCATGATCTAATTCTTAA
GATTTGGGGATATGAATCCATTTACGGATATGGGTGTGGGTATTTGCCTAAAAATAATTAAAATATCTAAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1570683.7e-0568 (13.1% of RFLP seq)+
SGN-U1570683.7e-0568 (13.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9410)
Chromosome
2
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG92 was used as an overgo probe on plate 6 [well B3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P196L19,   P035C10,   P269B11,   P052N14,   P169C09,   P013L04,   P240J17,   P125O11,   P164D04,   P119F22,   P205L20,   P018M07,   P152K21,   P110J08,   P113C13

 Overgo Sequences

A sequence
CAGCAGCACCAAAATCCCTATCGA
B sequence
GCGAGAGCTTCTGATTTCGATAGG
AB sequence
CAGCAGCACCAAAATCCCTATCGAAATCAG
Marker sequence
GGGGGGGGGGTATAGCTCCCCTTCCACAAAACTATGCTATAATAGCAGAA
AGAGAACTAAAATTTGCAATGCCCTGAGTTGAAAGATTATATGATTAACG
AGGTCTCCAGATCTTTTTAAAGCTTAAAATTGTTAATTTTACATGACCGC
AACTACTTAAATTAGAGGTGAAGTGTAACTTGGTTTTACTTATACCAGAT
ATACATCAATGATCCAACAAAAGAGTGCATTGATACACCAGTTACTCAGT
AATATATCCGCTGATCTGCATACATCTATCAGCAGCACCAAAATCCCTAT
CGAAATCAGAAGCTCTCGCTCTTGAAAATGAGCATATAGATTTTGTTATG
GAATGAGAAGTACCTACATCCTAAGTTGCTTGGACTCGGGTGCGGATGTC
CGATACAATTGCAGATCTAGAGGTTGGATTTTTCATGATCTAATTCTTAA
GATTTGGGGATATGAATCCATTTACGGATATGGGTGTGGGTATTTGCCTA
AAAATAATTAAAATATCTAA
Genomic location of TG92  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D535 marker 535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)