SGN Marker CT220

SGN-M538

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
GGGAAAATAAACATTTATCATTTCGACTGCCATATAGAATATAAATATCAAGTTCCTGACCATTACAAAAGTACTTTATCCATTAACCAA
TCAATAAACAGTATAACCAGCCAAAATAATTTAATGAACCATTCTTGTAAAACTTAAGGGGAATCAAGAAACATAACTTTAATCACCTAC
AACAACAAGAGAAGCCCTGCTTTTGTTTCGATCCATCGGTACCATCGTTGACCCCCCTGACTCTGTTGACAGATAATTCTGCTTTATAAC
AATC
Reverse sequence
GATTCTTATAAAGCCGAATTATCTGTCAACAGAGTCAACCTGGTCAACGATGGTACCGATGGATCGAAACAAAAGCAGGGCTACTCTTGT
TGTTCTAGGTGATTAATGTTATGTTTCTTGATTCCCCTTAAGTTTTACAAGAATGGTTCATTAAATTATTTTTGCTGGTCATACTGTTTA
TTGATTTGTTAATGGATAAAGTACTTTTGTAATGGTCAGGAACTTAATATTTATATTCTATATGGCAGCTGAAATGATAAATGTTTATTT
TCCCCAAAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1494102.2e-1768 (24.8% of RFLP seq)+
SGN-U1494101.1e-3168 (23.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51882)
Chromosome
9
Position
93.18 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39021)
Chromosome
9
Position
112.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9419)
Chromosome
9
Position
109.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT220 was used as an overgo probe on plate 14 [well G4]

Plausible BAC Matches:   P052M03,   P159B01,   P297O06,   P162J19,   P109D11,   P008K01,   P274B02,   P064H04,   P322F21,   P155J06,   P207H16,   P075O18,   P254B19,   P250P04,   P233N15,   P038K03,   P099K07,   P134O05,   P059I05,   P075O17,   P328M03,   P143A01,   P282J18,   P140I02,   P012N02,   P001D17,   P077N02

 Overgo Sequences

A sequence
GAAGCCCTGCTTTTGTTTCGATCC
B sequence
CAACGATGGTACCGATGGATCGAA
AB sequence
GAAGCCCTGCTTTTGTTTCGATCCATCGGT
Marker sequence
GGGAAAATAAACATTTATCATTTCGACTGCCATATAGAATATAAATATCA
AGTTCCTGACCATTACAAAAGTACTTTATCCATTAACCAATCAATAAACA
GTATAACCAGCCAAAATAATTTAATGAACCATTCTTGTAAAACTTAAGGG
GAATCAAGAAACATAACTTTAATCACCTACAACAACAAGAGAAGCCCTGC
TTTTGTTTCGATCCATCGGTACCATCGTTGACCCCCCTGACTCTGTTGAC
AGATAATTCTGCTTTATAACAATC
Genomic location of CT220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D538 marker 538
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)