SGN Marker TG94

SGN-M539

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGGGGGGGGGTTTCTGTCCAGAGAGAAATTTTTCGAGATAAATGTGTAAGCAAACTAAAAAAAAAAATATTAAGAATGAAAATATTTG
TAACAAGGTCAAAGTACCCTCGTGATAAGGGGGACGGGAACGGTTCAAACATATGAAGACAAAATGAATAGATGCCTCAATGAGGAGGTG
TTAAAAAATATGATTATTATGGGTATGAGGAGAGGTAAAAGTAGACTAAAAAAGTGTGGGGGAGAGTGGATAAACAAGATATGCATGACT
CTCCTATAGTTCACCAAAGACATGAGCCAAAGTAGAAAGATATTACTCGAGTATCTAACCAACTTCTCTACCTTCACAAGGTAGAAATAA
AACTGTGCACACGTCATTCCACCAGGACCTACTTGTGTGACTACACTCTGCCATATACGTTGTTGTTGTGGTGTGATGTTTTAACTAGGG
CTACGTTATTTTCTCAATATATGGTATATGCTATACATTATAATGATATATTAAGCATGACCTTTACCCTT
Reverse sequence
GGGGGGGGGGGGGGTTTCTGTCCAGGAAAATTTTTCGAGATAAATGTGTAAGCAAACTAGAAGAAAAAATATTAAGAATGAAAATATTTG
TAACAAGGTCAAAGTACCCTCGTGATAAGGGGGACGTGAACGGTTCAAACATATGAAGACAAAATGAATAGATGCCTCAATGAGGAGGTG
TTAAAGAATATGATTATTATGGGTATGAGGAGAGGTAAAAGTAGACTAAAAAAGTGTGGGGGAGAGTGGATAAACAAGATATGCATGACT
CTCCTATAGTTCACCAAAGACATGAGCCAAAGTAAAAAGATATTACTCGAGTATCTAACCAACTTCTCTACCTTCACAAGGTAAAAATAA
GACTGTGCACACGTCATTCCACCAGGACCTACTTGTGTGACTACACTCTGCCATATACGTTGTTGTTGTGGTGTGATGTTTTAACTAGTG
CTACGTTATTTTCTCAATATATGGTATATGCTATACATTATAATGATATATTAAGCATGACCTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9423)
Chromosome
3
Position
126.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG94 was used as an overgo probe on plate 2 [well B2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P177F14,   P210F21,   P129M18,   P269G06,   P140F13,   P010C15,   P188N24,   P177L08,   P032H11,   P251D10,   P159A22,   P176M23

 Overgo Sequences

A sequence
AAACTGTGCACACGTCATTCCACC
B sequence
CACACAAGTAGGTCCTGGTGGAAT
AB sequence
AAACTGTGCACACGTCATTCCACCAGGACC
Marker sequence
GGGGGGGGGGGGTTTCTGTCCAGAGAGAAATTTTTCGAGATAAATGTGTA
AGCAAACTAAAAAAAAAAATATTAAGAATGAAAATATTTGTAACAAGGTC
AAAGTACCCTCGTGATAAGGGGGACGGGAACGGTTCAAACATATGAAGAC
AAAATGAATAGATGCCTCAATGAGGAGGTGTTAAAAAATATGATTATTAT
GGGTATGAGGAGAGGTAAAAGTAGACTAAAAAAGTGTGGGGGAGAGTGGA
TAAACAAGATATGCATGACTCTCCTATAGTTCACCAAAGACATGAGCCAA
AGTAGAAAGATATTACTCGAGTATCTAACCAACTTCTCTACCTTCACAAG
GTAGAAATAAAACTGTGCACACGTCATTCCACCAGGACCTACTTGTGTGA
CTACACTCTGCCATATACGTTGTTGTTGTGGTGTGATGTTTTAACTAGGG
CTACGTTATTTTCTCAATATATGGTATATGCTATACATTATAATGATATA
TTAAGCATGACCTTTACCCTT
Genomic location of TG94  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D539 marker 539
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)