SGN Marker TG284

SGN-M54

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42433)
Chromosome
3
Position
129.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40853)
Chromosome
3
Position
0.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39978)
Chromosome
3
Position
123.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7883)
Chromosome
3
Position
140.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7882)
Chromosome
3
Position
92.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG284 was used as an overgo probe on plate 2 [well F12]

Plausible BAC Matches:   P247E22,   P041B05,   P323D22

 Overgo Sequences

A sequence
CTTCTAGGTATGACAGAATGCAGC
B sequence
TTTCAGGGCCACTGTTGCTGCATT
AB sequence
CTGGTGTGTTTTTGGGGTACTGTGAGTGGT
Marker sequence
TATGAGAATAGAAGTACAATAACAGTTGGATTATAGTTAAGTGGTGTAGA
ACTTTTAAGAGTAACTACTTGATTTCAAATAGTGGAATTCAAAAATATTT
TTCAACTAATTTGGAATAAAGGATTAAGTTGCTGATCTAATTAGTGACTT
TTATCAAATGTGACTCCGTTGAAACAATTTAAGAACAGCTCAAATTATGA
AATTATGGGTGAAAACAGTATCAGCTAAAGAAAAATATCTAATACAAATT
CTGATATTTTAACATTAAACGTTTCTACTTCAATGATTCTTCTAGGTATG
ACAGAATGCAGCAACAGTGGCCCTGAAATATTCGGGCACTATTCTGGTGT
GTTTTTGGGGTACTGTGAGTGGTGCCAAAGGATATTAGAAGCTTAATGTC
ATGCTGACTGGGACACAGGAATAACAGCAAACTGAAACAGATTTAGAAAA
CCATCCCACTGCCCACTGGGCA
Genomic location of TG284  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D54 marker 54
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)