SGN Marker TG95

SGN-M541

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG95 image not available
Forward sequence
GGGGGGGGGGGGGGTACCTGTAGATAAAAAATGGACAATAAAAAAAAATTATTACATTGTAGATGTCTGCTACACTTAATTAAGTAGTAC
TTATTTATTTAATTTTTATTGTAAAAATTCATTTATGTAGATAAAATTTTCTTATTATAATAACAACAACAATAAACAATATAACAATAA
TAGTAATAATTATTATCACAATATAACATCCTTTTAATTATATAAAACAAAAATATCTTTGATAAATTCAAAAATTAAAGTATTTTTCTG
TAAAATAAAAGATGAAATAACTAAAAGTATTATTAAAAATATATTTATTTAGAAATAAAAAATGATATTGCATTGGTTCTAACCCCATAC
CTTCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
Reverse sequence
GGGGGGGGGGGGGGTCTCTGTAGAAAAAAATGGACAAATAAAAAAAAATTATTACATTGTAGATGTCTGCTACACTTAATTAAGTAGTAC
TTATTTATTTAATTTTTATTGTAAAAATTCATTTATGTAGATAAAATTTTCTTATTATAATAACAACAACAATAAACAATATAACAATAA
TAGTAATAATTATTATCACAATATAACATCCTTTTAATTATATAAAACAAAAATATCTTTGATAAATTCAAAAATTAAAGTATTTTTCTG
TAAAATAAAAGATGAAATAACTAAAAGTATTATTAAAAATATATTTATTTAGAAATAAAAAATGATATTGCATTGGTTCTAACCCCATAC
CTTCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53864)
Chromosome
5
Position
78.00 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Tomato QTL map

Map: Tomato QTL map   
Map version
137 (location: 53865)
Chromosome
5
Position
43.20 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato QTL map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9424)
Chromosome
4
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG95 was used as an overgo probe on plate 10 [well F6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P216J13,   P109E08,   P190E11

 Overgo Sequences

A sequence
TTACATTGTAGATGTCTGCTACAC
B sequence
AGTACTACTTAATTAAGTGTAGCA
AB sequence
TTACATTGTAGATGTCTGCTACACTTAATT
Marker sequence
GGGGGGGGGGGGGGTACCTGTAGATAAAAAATGGACAATAAAAAAAAATT
ATTACATTGTAGATGTCTGCTACACTTAATTAAGTAGTACTTATTTATTT
AATTTTTATTGTAAAAATTCATTTATGTAGATAAAATTTTCTTATTATAA
TAACAACAACAATAAACAATATAACAATAATAGTAATAATTATTATCACA
ATATAACATCCTTTTAATTATATAAAACAAAAATATCTTTGATAAATTCA
AAAATTAAAGTATTTTTCTGTAAAATAAAAGATGAAATAACTAAAAGTAT
TATTAAAAATATATTTATTTAGAAATAAAAAATGATATTGCATTGGTTCT
AACCCCATACCTTCCCCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
Genomic location of TG95  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D541 marker 541
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)