SGN Marker CT223

SGN-M542

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT223 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTAAAACAGCAACATTAGATGTAATATTATCCACAGTAAAATCACAGCAATTACATATTAATGAAG
ATGCCAAGAAATATTTTGAAAAGATAACATGGAATACAACTTAAACTTAATAGTACAATACAAGGATAACATCTATTGCGCCAAAGCACT
TGTGTTGTAGACAAGGAGAGCACCTCCTGCAAGAATGCCAAGCAAGGTCACCGCCCATATGGCTAAGCCAGTGGTACCTCCAACATAGAC
ATCACCACTTGGAGACCATTCATCCGTGTTGTAGATGGGACTGTATCCATCAACATTAGCTCCATATTTGTCAACATATTGGTACACACC
CTTTCCCTTGGGCTTCCTGCCTGAGGCATCAACCCCATCTCTCAAGGGCATGCTTCCATTAATTCCATAGGGTTTGTCAGTCTTAAGCTT
CTTAACACCACTAGCCACAACTTTGAAGGAAGAAGAAGATCTAGTAAGT
Reverse sequence
CTTCCATCACTTACTAGATCTTCTTCTTCCTTCAAAGTTGTGGCTAGTGGTGTTAAGAAGCTTAAGACTGACAAACCCTATGGAATTAAT
GGAAGCATGGCCTTGAGAGATGGGGTTGATGCCTCAGGCAGGAAGCCCAAGGGAAAGGGTGTGTACCAATATGTTGACAAATATGGAGCT
AATGTTGATGGATACAGTCCCATCTACAACACGGATGAATGGTCTCCAAGTGGTGATGTCTATGTTGGAGGTACCACTGGCTTAGCCATA
TGGGCGGTGACCTTGCTTGGCATTCTTGCAGGAGGTGCTCTCCTTGTCTACAACACAAGTGCTTTGGCGCAATAGATGTTATCCTTGTAT
TGTACTATTAAGTTTAAGTTGTATTCCATGTTATCTTTTCAAAATATTTCTTGGCATCTTCATTAATATGTAATTGCTGTGATTTTACTG
TGGATAATATTACATCTAATGTTGCTGTTTTAAAAAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1492618.9e-0661 (12.2% of RFLP seq)+
SGN-U1493959.2e-0930 (6.0% of RFLP seq)+
SGN-U1493959.6e-1239 (7.8% of RFLP seq)+
SGN-U1492605.5e-41176 (35.3% of RFLP seq)+
SGN-U1624842.3e-43176 (35.3% of RFLP seq)+
SGN-U1432102.3e-4697 (19.4% of RFLP seq)+
SGN-U1432105.7e-81151 (30.3% of RFLP seq)+
SGN-U1603813.7e-82169 (33.9% of RFLP seq)+
SGN-U1677811.5e-84389 (78.0% of RFLP seq)+
SGN-U1432111e-122221 (44.3% of RFLP seq)+
SGN-U143215473 (94.8% of RFLP seq)+
SGN-U143214473 (94.8% of RFLP seq)+
SGN-U1492618.9e-0661 (12.2% of RFLP seq)-
SGN-U1493959.3e-0930 (6.0% of RFLP seq)-
SGN-U1493959.6e-1239 (7.8% of RFLP seq)-
SGN-U1492605.5e-41176 (35.1% of RFLP seq)-
SGN-U1624842.3e-43176 (35.1% of RFLP seq)-
SGN-U1432101.6e-53105 (21.0% of RFLP seq)-
SGN-U1432105.8e-81151 (30.1% of RFLP seq)-
SGN-U1677814e-88415 (82.8% of RFLP seq)-
SGN-U1603812.5e-89177 (35.3% of RFLP seq)-
SGN-U1432111e-122221 (44.1% of RFLP seq)-
SGN-U143215481 (96.0% of RFLP seq)-
SGN-U143214481 (96.0% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42330)
Chromosome
7
Position
112.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39022)
Chromosome
7
Position
95.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9426)
Chromosome
7
Position
129.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9425)
Chromosome
7
Position
89.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT223 was used as an overgo probe on plate 7 [well E8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACCACTTGGAGACCATTCATCCGT
B sequence
CAGTCCCATCTACAACACGGATGA
AB sequence
ACCACTTGGAGACCATTCATCCGTGTTGTA
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTAAAACAGCAACATTAGATGTAATA
TTATCCACAGTAAAATCACAGCAATTACATATTAATGAAGATGCCAAGAA
ATATTTTGAAAAGATAACATGGAATACAACTTAAACTTAATAGTACAATA
CAAGGATAACATCTATTGCGCCAAAGCACTTGTGTTGTAGACAAGGAGAG
CACCTCCTGCAAGAATGCCAAGCAAGGTCACCGCCCATATGGCTAAGCCA
GTGGTACCTCCAACATAGACATCACCACTTGGAGACCATTCATCCGTGTT
GTAGATGGGACTGTATCCATCAACATTAGCTCCATATTTGTCAACATATT
GGTACACACCCTTTCCCTTGGGCTTCCTGCCTGAGGCATCAACCCCATCT
CTCAAGGGCATGCTTCCATTAATTCCATAGGGTTTGTCAGTCTTAAGCTT
CTTAACACCACTAGCCACAACTTTGAAGGAAGAAGAAGATCTAGTAAGT
Genomic location of CT223  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D542 marker 542
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)