SGN Marker TG97

SGN-M544

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG97 image not available
Forward sequence
GGGGGGGGGGGTTATGACTTTATTTGATAAAAATCCTAAAGTGAATGACCCTTTGAGATGTGTTATATATTCTAAAAGCTCCAGTAATGT
AAAAGAAAAATACAATAACAACTAACACCACATAATTGAGAAGGACAACACTTTCACTTCTAAGAGTTAAATTAAAAATTAACCTATAAT
TTTAATTTCAAGATAAAAAACTTATATAAATAATATGCAAAACTAGAAGAAGTCCAGGACATATATATTGACCTCAAAATCTAGAATATC
ATAAATCACCAATAATAAAAAAGTAAACCTATTTATACATTTATTTCTAGAGGCAACTAATAAAAAAGTAAACCTATTTATACTTTTATT
TTGTAGAGGCAACAACAAATGATATTAAAATATGGAATGACTAATACCTTCCTCCAAAATTAAACATGCTAGATTCCGGATGACTTCAAT
AGCAATGATGTCATAATTATCTACTACTATTACTATTTATTTTTTATATAAGTTTCGCTACATGATATAATCA
Reverse sequence
GGGGGGGGGGGTTATGACTTTATTTGATAAAATCCTAAAGTGAATGACCCTTTGAGATGTGTTATATATTCTAAAAGCTCCAGTAATGTA
AAAGAAAAATACAATAACAACTAACACCACATAATTGAGAAGGACAACACTTTCACTTCTAAGAGTTAAATTAAAAATTAACCTATAATT
TTAATTTCAAGATAAAAAACTTATATAAATAATATGCAAAACTAGAAGAAGTCCAGGACATATATATTGACCTCAAAATCTAGAATATCA
TAAATCACCAATAATAAAAAAGTAAACCTATTTATACATTTATTTCTAGAGGCAACTAATAAAAAAGTAAACCTATTTATACTTTTATTT
TGTAGAGGCAACAACAAATGATATTAAAATATGGAATGACTAATACCTTCCTCCAAAATTAAACATGCTAGATTCCGGATGACTTCAATA
GCAATGATGTCATAATTATCTACTACTATTACTATTTATTTTTTATATAAGTTTCGCTACATGATATAATCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9430)
Chromosome
6
Position
8.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG97 was used as an overgo probe on plate 2 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P196B03,   P288H19,   P186J23,   P112N03,   P144A23,   P135B14,   P064K06,   P211P24,   P178B12,   P266E23,   P229D14,   P268A07,   P156J22,   P099C08,   P010M13,   P065D05,   P267E23,   P166L14,   P334B04,   P023C01,   P125J18,   P030L24,   P107H19,   P107L02,   P113J24,   P161D16,   P084G05,   P106P19,   P098D03,   P114H06,   P103C09,   P286P11,   P166J24

 Overgo Sequences

A sequence
TACCTTCCTCCAAAATTAAACATG
B sequence
GTCATCCGGAATCTAGCATGTTTA
AB sequence
TACCTTCCTCCAAAATTAAACATGCTAGAT
Marker sequence
GGGGGGGGGGGTTATGACTTTATTTGATAAAAATCCTAAAGTGAATGACC
CTTTGAGATGTGTTATATATTCTAAAAGCTCCAGTAATGTAAAAGAAAAA
TACAATAACAACTAACACCACATAATTGAGAAGGACAACACTTTCACTTC
TAAGAGTTAAATTAAAAATTAACCTATAATTTTAATTTCAAGATAAAAAA
CTTATATAAATAATATGCAAAACTAGAAGAAGTCCAGGACATATATATTG
ACCTCAAAATCTAGAATATCATAAATCACCAATAATAAAAAAGTAAACCT
ATTTATACATTTATTTCTAGAGGCAACTAATAAAAAAGTAAACCTATTTA
TACTTTTATTTTGTAGAGGCAACAACAAATGATATTAAAATATGGAATGA
CTAATACCTTCCTCCAAAATTAAACATGCTAGATTCCGGATGACTTCAAT
AGCAATGATGTCATAATTATCTACTACTATTACTATTTATTTTTTATATA
AGTTTCGCTACATGATATAATCA
Genomic location of TG97  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D544 marker 544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)