SGN Marker CT94

SGN-M546

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT94 image not available
Forward sequence
CTTTTTTTTTTTTTTTCACTGTAGAAGTATCACATGATATATATTGGGGAATTATATAAAAGCTGAAGCATTTTAACACTCTAGGTAGCA
ACATGAGGAACATAACATTTTTCATACTGAAAAAATTAACCAAAATTCAGTTGAAGAATAAGACTATCATTGTCAACATACCAAGGGGGA
AAAACTGGCAGCTAGAAAATGCACATGGGATGTGATAAAAGTATCTGTTACATGTTGATACTCTTCTCCAATCCCTTGCTTACTTCTATA
TCCAAATCTCCTATAAAATGACAAGTTATATTTTACTAGGAAAATGTCAAGTTGAACATTCATCATCTCAGACATGCCGAAGTGGATTCT
AGTGTATACTGTACCTATTCCGACTCCATAATTCTACACAGGGTAATATAGTAGATATCGAGCATCCGTGGATGAAACTCATGTAACTTC
TGCGTGGAACTCTCTTTTTCTTCTCATAGTAGAAACAACACCATTACAGAAGACAATGA
Reverse sequence
TTTTTTTTGTTTTTCATTTACTATCCCATGCTGCCGTGTTTCTCGGAGAAGCACAGTATGTGGAGAAGACACAGCACAGGAGGAGGAGGC
GCTAATGGTTACTTCATTTTGGTACTGTGTCACTTGGCTCTTCACTGCTTACTCATCACTCGCTCAACTGCTTGTTCTAATGGGAATTGC
CAGCTTCTTGATTCATGTGCTTCGGCTACGGATTGTGGGCCTTCTTTATACTGTGGTGATTGCCCTGAATTGGGAAAGAGTCAGCCCTTT
TGCATCAGAGGACAAGCTATAGAACCTACTTCCATTATCAGTGGATTGCCCTTTCACAAATACTCGTGGTTGGTCACCCATAATGCCTTT
TCAATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U154124416 (81.7% of RFLP seq)+
SGN-U151296350 (95.6% of RFLP seq)-
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 42974)
Chromosome
2
Position
70.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43974
Forward primer (5'-3')
CTGAAGCATTTTAACACTCTAGGT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CTGTGTAGAATTATGGAGTCGGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-AC99   
Map version
34 (location: 9433)
Chromosome
2
Position
105.55 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9432)
Chromosome
2
Position
123.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT94 was used as an overgo probe on plate 16 [well H7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P213G11,   P242E24,   P165L19,   P304O07,   P116J12,   P294O24,   P309F21

 Overgo Sequences

A sequence
AGCATCCGTGGATGAAACTCATGT
B sequence
GTTCCACGCAGAAGTTACATGAGT
AB sequence
AGCATCCGTGGATGAAACTCATGTAACTTC
Marker sequence
CTTTTTTTTTTTTTTTCACTGTAGAAGTATCACATGATATATATTGGGGA
ATTATATAAAAGCTGAAGCATTTTAACACTCTAGGTAGCAACATGAGGAA
CATAACATTTTTCATACTGAAAAAATTAACCAAAATTCAGTTGAAGAATA
AGACTATCATTGTCAACATACCAAGGGGGAAAAACTGGCAGCTAGAAAAT
GCACATGGGATGTGATAAAAGTATCTGTTACATGTTGATACTCTTCTCCA
ATCCCTTGCTTACTTCTATATCCAAATCTCCTATAAAATGACAAGTTATA
TTTTACTAGGAAAATGTCAAGTTGAACATTCATCATCTCAGACATGCCGA
AGTGGATTCTAGTGTATACTGTACCTATTCCGACTCCATAATTCTACACA
GGGTAATATAGTAGATATCGAGCATCCGTGGATGAAACTCATGTAACTTC
TGCGTGGAACTCTCTTTTTCTTCTCATAGTAGAAACAACACCATTACAGA
AGACAATGA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT94  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D546 marker 546
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)