SGN Marker CT95

SGN-M549

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT95 image not available
Forward sequence
ATTGTGGATTCTTTGTCTTGTTATCTCCACTTTGGATTCTATAATATTATTATTATTATTGTTATTATTGATTGATGTTGATTCTTCATC
CTCGTCTTTTTTCTTGTATGACTTGAAAAACTCTTTGTTCTCCTTCTCCAACTCTTTCCACACTGTTATACATATAAAAAAAAGGTTAAT
TAATTAAATAAACATGTTCTATTTAATTTATTAAAATTAACTAATATAATAATCACACAACAAATAATTACGAAAGAAATTGATTGTTCA
AATAGTCAGTCAACTAGGGTAAATAAATAGTTGAGTAAATTCATTTTGCGTGTGTAATTACATTCTCATGCGTGTTGTTGAGTGTTATTT
CACAATGTTGGTGGCACATGGATCCAATATTAAAGTTACAAGTTAAATAGATTTCACTTTTTCTTGATAGAATTATATAATTAAAAATGA
TAGTGTTATACACGTAAAACAAAAACAAGAAAATAAACTTATAAATATAAAT
Reverse sequence
GTTAAATCTTTTGAGTCAAATAAATCTTTCAAATACTGTTTTTACATCATTTTCAAAAACAAAATCAAGTTGAAAAGAATACAGCTAATT
AAAATAATTTATTTGTCTTATTTAATATTTTTAAAAACGTGAAAAATATTGACTTTGGAGGAACAAAAAGTGAACCGACGAGATCTAGAG
TGAAATAAACGAGATCTATTATTCTTAACTAAAAAATTTTAAATTTAAAATCTGAATATAATATATATTTTCTTTTAGATATTAAGTAAT
ATTTCTTCTTTAAATGAATATCACGTGAATTTAAAATTACTCAAATCGCCTCATGAAAACAACAATATCATGCCTAAAATACGGATAGAG
TCAATAGAGATATAATCGTCAATTCAAGTTTTTATTTATATTTGTGCGTTATTTTTATTTGTATAGATTGAAACAATCTCTGCTCACTTT
TTTTTCCTATTATATATTTATATTTATAAGTTTTTTTTTTTGTTTTTGTTTTACGTGTATAACACTATCATTTTTAAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53755)
Chromosome
10
Position
70.30 cM
Confidence
uncalculated
Protocol
RFLP


Tomato QTL map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39084)
Chromosome
10
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9442)
Chromosome
10
Position
85.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9443)
Chromosome
10
Position
75.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9447)
Chromosome
10
Position
80.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT95 was used as an overgo probe on plate 5 [well B10]

Plausible BAC Matches:   P141G03,   P146G05,   P053L16,   P236G08,   P011E16,   P168A08,   P015J19,   P071I23,   P144F17,   P070D12

 Overgo Sequences

A sequence
ATGCGTGTTGTTGAGTGTTATTTC
B sequence
GTGCCACCAACATTGTGAAATAAC
AB sequence
ATGCGTGTTGTTGAGTGTTATTTCACAATG
Marker sequence
ATTGTGGATTCTTTGTCTTGTTATCTCCACTTTGGATTCTATAATATTAT
TATTATTATTGTTATTATTGATTGATGTTGATTCTTCATCCTCGTCTTTT
TTCTTGTATGACTTGAAAAACTCTTTGTTCTCCTTCTCCAACTCTTTCCA
CACTGTTATACATATAAAAAAAAGGTTAATTAATTAAATAAACATGTTCT
ATTTAATTTATTAAAATTAACTAATATAATAATCACACAACAAATAATTA
CGAAAGAAATTGATTGTTCAAATAGTCAGTCAACTAGGGTAAATAAATAG
TTGAGTAAATTCATTTTGCGTGTGTAATTACATTCTCATGCGTGTTGTTG
AGTGTTATTTCACAATGTTGGTGGCACATGGATCCAATATTAAAGTTACA
AGTTAAATAGATTTCACTTTTTCTTGATAGAATTATATAATTAAAAATGA
TAGTGTTATACACGTAAAACAAAAACAAGAAAATAAACTTATAAATATAA
AT
Genomic location of CT95  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D549 marker 549
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)