SGN Marker TG214

SGN-M55

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATTTTAGTGTCCAATCTTCTGGATGGGAATGAAGATGAACTTGGTTGGCCCAGTCACGTTCTTTGCTCTGTTATTCTTCCCAAGTTGTTG
GTTTTGAAAGAACCATCTTCTCGTGTATTACTAACGGCATCGGTAGAGTACTCTAAGGTTCATCAGAGAG
Reverse sequence
CTCTCTGATGAACCTTAGAGTACTCTACCGATGCCGTTAGTAATACACGAGAAGATGGTTCTTTCAAAACCAACAACTTGGGAAGAATAA
CAGAGCAAAGAACGTGACTGGGCCAACCAAGTTCATCTTCATTCCCATCCAGAAGATTGGACACTAAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53877)
Chromosome
3
Position
116.80 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53525)
Chromosome
3
Position
85.76 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43847)
Chromosome
3
Position
108.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43591)
Chromosome
3
Position
97.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43307)
Chromosome
3
Position
98.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40845)
Chromosome
3
Position
112.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39942)
Chromosome
3
Position
158.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7887)
Chromosome
3
Position
116.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7890)
Chromosome
3
Position
117.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG214 was used as an overgo probe on plate 2 [well F5]

Plausible BAC Matches:   P194H01,   P227C19,   P104H05,   P013P12,   P207C16,   P243I23,   P021A14,   P213M15,   P036A23,   P260O16,   P263A15,   P250J02

 Overgo Sequences

A sequence
CCAATCTTCTGGATGGGAATGAAG
B sequence
GGCCAACCAAGTTCATCTTCATTC
AB sequence
CCAATCTTCTGGATGGGAATGAAGATGAAC
Marker sequence
ATTTTAGTGTCCAATCTTCTGGATGGGAATGAAGATGAACTTGGTTGGCC
CAGTCACGTTCTTTGCTCTGTTATTCTTCCCAAGTTGTTGGTTTTGAAAG
AACCATCTTCTCGTGTATTACTAACGGCATCGGTAGAGTACTCTAAGGTT
CATCAGAGAG
Genomic location of TG214  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D55 marker 55
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)