SGN Marker CT96

SGN-M550

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
150
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT96 image not available
Forward sequence
CACCAATCGTAAAACCGCCCGTCATATTGCCACCTGTCGGAATTCCTTTCAAAATCCCACCTTTCAAATCTCTATATTTCCTCTCCCCTG
TTTCCTTTGGTCTCCGGTTGCTCTGTCCGCCGTGAAAACCCTAGCTTTCTCCTCCCTTCTCACAGATCCGAACGC
Reverse sequence
GCGTTCGGATCTGTGAGAAGGGAGGAGAAAGCTAGGGTTTTCACGGCGGACAGAGCAACCGGAGACCAAAGGAAACAGGGGAGAGGAAAT
ATAGAGATTTGAAAGGTGGGATTTTGAAAGGAATTCCGACAGGTGGCAATATGACGGGCGGTTTTACGATTGGTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1442896.9e-0746 (27.9% of RFLP seq)+
SGN-U1442891.2e-1146 (27.9% of RFLP seq)+
SGN-U1442898.1e-1946 (27.9% of RFLP seq)+
SGN-U1442896.9e-0746 (27.9% of RFLP seq)-
SGN-U1442891.2e-1146 (27.9% of RFLP seq)-
SGN-U1442898.1e-1946 (27.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53482)
Chromosome
9
Position
77.81 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9448)
Chromosome
9
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT96 was used as an overgo probe on plate 15 [well A7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P166C22,   P243K18,   P202N19,   P070A06,   P331G11,   P042N13,   P108O07,   P275A23,   P132O12,   P042M21,   P055M10,   P154C12,   P211M21

 Overgo Sequences

A sequence
TAAAACCGCCCGTCATATTGCCAC
B sequence
AAAGGAATTCCGACAGGTGGCAAT
AB sequence
TAAAACCGCCCGTCATATTGCCACCTGTCG
Marker sequence
CACCAATCGTAAAACCGCCCGTCATATTGCCACCTGTCGGAATTCCTTTC
AAAATCCCACCTTTCAAATCTCTATATTTCCTCTCCCCTGTTTCCTTTGG
TCTCCGGTTGCTCTGTCCGCCGTGAAAACCCTAGCTTTCTCCTCCCTTCT
CACAGATCCGAACGC
Genomic location of CT96  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D550 marker 550
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)