SGN Marker CT153

SGN-M551

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT153 image not available
Forward sequence
CTTTTTTTTTTTCTTTCTCCTCCATATCCAAAAAACCATCGGGAATCTATGGCCTCTTCTTCACTGAAACAGCTAGCCGACCAAACGACC
AGCAACAAAATAGATCCAAAAACGACCTTCAAAATGCAGCTGGAACAGCCACTCAAATAGGCAACTACCTAACCCCAACTCGCCTGAAAT
CACCATTGGTCCTGCCATCTTCTTCCCCAACTCAACAACCACAAAAGTCCCTCCTTCGTTTCCTCCTTTTTTCGGCGACGAATAGCCGCA
AATCTTAACCAATAACCACCAGACCCACCTCCATCCTCCCCTTTCTTCTCCAACATCAACAGAAAAAAATTTAACCATCATCTTAGAAAA
AAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTCTAAGATGATGGTTAAATTTTTTTCTGTTGATGTTGGAAAAAAAAGGGGAGGATGGAGGTGGGTCTGGTGGTTATT
GGTTAAAATTTGCGGCTATTCGTCCCCGAAAAAAGGAGGAAACGAAGGAGGGACTTTTGTGGTTGTTGAGTTGGGGAAAAAGATGGCAGG
ACCAATGGTGATTTCAGGCGAGTTGGGGTTAGGTAGTTGCCTATTTGAGTGGCTGTTCCAGCTGCATTTTGAAGGTCGTTTTTGGATCTA
TTTTGTTGCTGGTCGTTTGGTCGGCTAGCTGTTTCAGTGAAGAAGAGGCCATAGATTCCCGATGGTTTTTTGGATATGGAGGAGAAAGAA
AAAAAAAAAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9449)
Chromosome
8
Position
12.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT153 was used as an overgo probe on plate 12 [well B7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P249E24,   P008D18,   P103F05,   P127P18,   P271O22,   P092H06,   P130P19,   P083F17,   P294M15,   P333E23,   P294I01,   P154H15,   P231A04,   P267J03,   P326O05,   P297M04,   P130H06,   P014N24,   P174E19,   P205G08

 Overgo Sequences

A sequence
CACAAAAGTCCCTCCTTCGTTTCC
B sequence
GTCGCCGAAAAAAGGAGGAAACGA
AB sequence
CACAAAAGTCCCTCCTTCGTTTCCTCCTTT
Marker sequence
CTTTTTTTTTTTCTTTCTCCTCCATATCCAAAAAACCATCGGGAATCTAT
GGCCTCTTCTTCACTGAAACAGCTAGCCGACCAAACGACCAGCAACAAAA
TAGATCCAAAAACGACCTTCAAAATGCAGCTGGAACAGCCACTCAAATAG
GCAACTACCTAACCCCAACTCGCCTGAAATCACCATTGGTCCTGCCATCT
TCTTCCCCAACTCAACAACCACAAAAGTCCCTCCTTCGTTTCCTCCTTTT
TTCGGCGACGAATAGCCGCAAATCTTAACCAATAACCACCAGACCCACCT
CCATCCTCCCCTTTCTTCTCCAACATCAACAGAAAAAAATTTAACCATCA
TCTTAGAAAAAAAAAAAAAA
Genomic location of CT153  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D551 marker 551
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)