SGN Marker Hpms1-139

SGN-M5530

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41601)
Chromosome
1
Position
195.10 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43569
Forward primer (5'-3')
CCAACAGTAGGACCCGAAAATCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATGAAGGCTACTGCTGCGATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 13941)
Chromosome
1
Position
50.54 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34614
Forward primer (5'-3')
CCAACAGTAGGACCCGAAAATCC
Accessions and product sizes
Capsicum frutescens BG2814-6
299
Capsicum annuum NuMex-RNaky
299
Approximate temperature
Unknown
Reverse primer (5'-3')
ATGAAGGCTACTGCTGCGATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-139  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5530 marker 5530
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)