SGN Marker CT155

SGN-M554

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT155 image not available
Forward sequence
TTCTACTTGACTTTTAAATAGAGGTTTCTTGTGCCGAAAATACTTATGAAAATCATATCTGATGGCTACCCTAGCAAGTTTTTCGGTATC
CACGGTAGCCGCTCGCAGCCGAGTCAACTGTTCCGGAGCCAAATCCCGGATGTAGAAGATAATGGTACTTTGCTATCAACATATTTAACA
CGGAGTCACCTACGTATTCAAGCCTTTCATATGATTCATACTTATCTTCTCGA
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9455)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT155 was used as an overgo probe on plate 14 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTCAACTGTTCCGGAGCCAAATC
B sequence
TATCTTCTACATCCGGGATTTGGC
AB sequence
AGTCAACTGTTCCGGAGCCAAATCCCGGAT
Marker sequence
TTCTACTTGACTTTTAAATAGAGGTTTCTTGTGCCGAAAATACTTATGAA
AATCATATCTGATGGCTACCCTAGCAAGTTTTTCGGTATCCACGGTAGCC
GCTCGCAGCCGAGTCAACTGTTCCGGAGCCAAATCCCGGATGTAGAAGAT
AATGGTACTTTGCTATCAACATATTTAACACGGAGTCACCTACGTATTCA
AGCCTTTCATATGATTCATACTTATCTTCTCGA
Genomic location of CT155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D554 marker 554
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)