SGN Marker BD76366

SGN-M5546

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41277)
Chromosome
2
Position
85.90 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43254
Forward primer (5'-3')
AAAACTCCAAACTACCCCTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTAAGCGTAGCGCTTGTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 13962)
Chromosome
2
Position
54.63 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34588
Forward primer (5'-3')
AAAACTCCAAACTACCCCTGG
Accessions and product sizes
Capsicum frutescens BG2814-6
330
Capsicum annuum NuMex-RNaky
330
Approximate temperature
Unknown
Reverse primer (5'-3')
TTAAGCGTAGCGCTTGTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of BD76366  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5546 marker 5546
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)